WARNING: This summary was generated by AI. MIR873 is a microRNA involved in various biological processes and has been implicated in the modulation of cancer cell sensitivity to treatments and the development of diverse tumors [PMC7589921]. It is a small noncoding RNA molecule that contributes to posttranscriptional gene regulation and RNA silencing [PMC7589921]. In the context of thyroid cancer, MIR873 is significantly deregulated, indicating its potential role in tumorigenesis [PMC4621222]. It has also been identified as upregulated during fungal infection in plants, suggesting its involvement in stress responses [PMC6965360]. In neuroblastoma (NB), MIR873 is considered a candidate microRNA that may have antagonistic effects depending on the miRISC complex status [PMC8017594]. Furthermore, MIR873 has been associated with oncogenesis and chemoresistance, as well as with adjustments in miRNA expression profiles following quercetin treatment in colon cancer cell lines [PMC5058679; PMC9380290].. Genetic studies have linked MIR873 to bone geometry and appendicular lean mass (ALM), with identified target genes suggesting its role in bone and muscle metabolism regulation [PMC3210160; PMC3706967].. Additionally, MIR873's involvement has been observed in insulin sensitivity during pregnancy, highlighting its potential impact on metabolic processes [PMC8900031; PMC7073212]..
-- u ca G A G a ga gug g uuu C GGAACUUGU AGUCUCCU uu a ||| | ||| | ||||||||| |||||||| || a cac c aAG G CCUUGAGUA UCAGAGGa aa a aa c ac G C G c gu
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004953 |
| Description | Homo sapiens hsa-miR-873-5p mature miRNA |
| Sequence | 11 - GCAGGAACUUGUGAGUCUCCU - 31 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0022717 |
| Description | Homo sapiens hsa-miR-873-3p mature miRNA |
| Sequence | 46 - GGAGACUGAUGAGUUCCCGGGA - 67 |
| Evidence | not_experimental |
| Database links |
|
| Predicted targets |
|
|