miRBase entry: hsa-mir-873

Stem-loop hsa-mir-873


Accession
MI0005564
Symbol
HGNC: MIR873
Description
Homo sapiens hsa-mir-873 precursor miRNA mir-873
Gene
family?
RF00910; mir-873

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR873 is a microRNA involved in various biological processes and has been implicated in the modulation of cancer cell sensitivity to treatments and the development of diverse tumors [PMC7589921]. It is a small noncoding RNA molecule that contributes to posttranscriptional gene regulation and RNA silencing [PMC7589921]. In the context of thyroid cancer, MIR873 is significantly deregulated, indicating its potential role in tumorigenesis [PMC4621222]. It has also been identified as upregulated during fungal infection in plants, suggesting its involvement in stress responses [PMC6965360]. In neuroblastoma (NB), MIR873 is considered a candidate microRNA that may have antagonistic effects depending on the miRISC complex status [PMC8017594]. Furthermore, MIR873 has been associated with oncogenesis and chemoresistance, as well as with adjustments in miRNA expression profiles following quercetin treatment in colon cancer cell lines [PMC5058679; PMC9380290].. Genetic studies have linked MIR873 to bone geometry and appendicular lean mass (ALM), with identified target genes suggesting its role in bone and muscle metabolism regulation [PMC3210160; PMC3706967].. Additionally, MIR873's involvement has been observed in insulin sensitivity during pregnancy, highlighting its potential impact on metabolic processes [PMC8900031; PMC7073212]..

Literature search
88 open access papers mention hsa-mir-873
(347 sentences)

Sequence

16231 reads, 30.0 reads per million, 156 experiments
gugugcauuuGCAGGAACUUGUGAGUCUCCUauugaaaaugaacagGAGACUGAUGAGUUCCCGGGAacacccacaa
(((.(..(((.(.(((((((((.((((((((.((.......)).)))))))).))))))))).).)))..).)))..

Structure
--   u ca   G A         G        a  ga 
  gug g  uuu C GGAACUUGU AGUCUCCU uu  a
  ||| |  ||| | ||||||||| |||||||| ||  a
  cac c  aAG G CCUUGAGUA UCAGAGga aa  a
aa   c ac   G C         G        c  gu 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
chr9: 28888879-28888955 [-]

Disease association
hsa-mir-873 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-873-5p

Accession MIMAT0004953
Description Homo sapiens hsa-miR-873-5p mature miRNA
Sequence 11 - GCAGGAACUUGUGAGUCUCCU - 31
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-873-3p

Accession MIMAT0022717
Description Homo sapiens hsa-miR-873-3p mature miRNA
Sequence 47 - GAGACUGAUGAGUUCCCGGGA - 67
Evidence not_experimental
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298