MIR543 is a microRNA that has been implicated in various biological processes and diseases. It has been reported to negatively regulate Raf kinase inhibitory protein (RKIP), an endogenous inhibitor of ERK [PMC6413650]. RKIP binds to the Notch receptor and inhibits its cleavage, thereby modulating stem cell aging through RKIP-associated Notch regulation and direct AIMP3 suppression [PMC6413650]. In gastric cancer (GC) cells, MIR543 expression is upregulated, promoting cell cycle and proliferation, and is positively correlated with the clinical phenotype of GC patients [PMC8826423]. MIR543 is also known to target Th2 via IL-10, IL-12, JUN, JAK1, JAG1, PIK3R1, TBX21, TGF b1, TGFBR1, CCR3, and CD40 genes [PMC8482137]. It has been associated with mesenchymal stem cell differentiation [PMC5572416] and implicated in regulating motor behavior by modulating neuronal signaling networks and excitability in adult neurons [PMC5764268]. MIR543 also binds to the 3'-untranslated region of the N-cadherin (N-cad) transcript and regulates neurogenesis and neuronal migration by fine-tuning N-cad levels [PMC4682034]. In various experimental conditions such as cisplatin treatment with or without mesenchymal stem cells (MSCs), MIR543 expression levels have been found to be altered [PMC5206861].
-- u u u - uu u - uuu uacu aa gagaagu gc ccgug u uuucg c a |||| || ||||||| || ||||| | ||||| | u auga uu UUCUUCA CG GGCGC A AAAgc g u cu c u - U UU C a ugu
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004954 |
Description | Homo sapiens hsa-miR-543 mature miRNA |
Sequence | 47 - AAACAUUCGCGGUGCACUUCUU - 68 |
Evidence |
experimental
RAKE [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|