WARNING: This summary was generated by AI. MicroRNA 543 (MIR543) is implicated in various cellular processes, including stem cell aging, cell cycle regulation, and cellular differentiation [PMC6413650; PMC6456586;'>PMC6456586; PMC5572416].. MIR543 negatively regulates Raf kinase inhibitory protein (RKIP), which in turn is involved in Notch signaling and may influence stem cell aging through this pathway [PMC6413650]. In gastric cancer (GC) cells, MIR543 is upregulated, which promotes proliferation and correlates with the clinical phenotype of GC patients [PMC8826423]. Despite its upregulation in GC cells, MIR543 is generally expressed at low levels in cells [PMC6456586]. In the context of hepatocellular carcinoma (HCC), MIR543 expression was not elevated in tumors developed from glycogen storage disease (GSD) Ia complications, suggesting its expression may not be associated with HCC tumorigenesis due to GSD Ia [PMC6909089]. Additionally, MIR543 is part of the miR379–410 cluster and has been shown to regulate neuronal differentiation and migration by binding to the 3′UTR of N-cadherin transcripts [PMC5928554; PMC4682034].. In therapeutic contexts involving mesenchymal stem cells (MSCs), MIR543 was among the miRNAs downregulated when MSCs were used alongside cisplatin treatment compared to cisplatin treatment alone [PMC5206861].
-- u u U - UU U - uuu uacu aa gaGAAGU GC CCGUG U UUUCG c a |||| || ||||||| || ||||| | ||||| | u auga uu UUCUUCA CG GGCGC A AAAgc g u cu c u - U UU C a ugu
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0050514 |
| Description | Homo sapiens hsa-miR-543-5p mature miRNA |
| Sequence | 11 - GAAGUUGCCCGUGUUUUUUUCG - 32 |
| Evidence |
experimental
RAKE [1] |
| Accession | MIMAT0004954 |
| Description | Homo sapiens hsa-miR-543-3p mature miRNA |
| Sequence | 47 - AAACAUUCGCGGUGCACUUCUU - 68 |
| Evidence |
experimental
RAKE [1] |
| Database links |
|
| Predicted targets |
|
|