miRBase entry: hsa-mir-543

Stem-loop hsa-mir-543


Accession
MI0005565
Symbol
HGNC: MIR543
Description
Homo sapiens hsa-mir-543 precursor miRNA mir-329
Gene
family?
RF04295; mir-329

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR543 is a microRNA that has been implicated in various biological processes and diseases. It has been reported to negatively regulate Raf kinase inhibitory protein (RKIP), an endogenous inhibitor of ERK [PMC6413650]. RKIP binds to the Notch receptor and inhibits its cleavage, thereby modulating stem cell aging through RKIP-associated Notch regulation and direct AIMP3 suppression [PMC6413650]. In gastric cancer (GC) cells, MIR543 expression is upregulated, promoting cell cycle and proliferation, and is positively correlated with the clinical phenotype of GC patients [PMC8826423]. MIR543 is also known to target Th2 via IL-10, IL-12, JUN, JAK1, JAG1, PIK3R1, TBX21, TGF b1, TGFBR1, CCR3, and CD40 genes [PMC8482137]. It has been associated with mesenchymal stem cell differentiation [PMC5572416] and implicated in regulating motor behavior by modulating neuronal signaling networks and excitability in adult neurons [PMC5764268]. MIR543 also binds to the 3'-untranslated region of the N-cadherin (N-cad) transcript and regulates neurogenesis and neuronal migration by fine-tuning N-cad levels [PMC4682034]. In various experimental conditions such as cisplatin treatment with or without mesenchymal stem cells (MSCs), MIR543 expression levels have been found to be altered [PMC5206861].

Literature search
25 open access papers mention hsa-mir-543
(50 sentences)

Sequence

3721 reads, 71 reads per million, 68 experiments
uacuuaaugagaaguugcccguguuuuuuucgcuuuauuugugacgAAACAUUCGCGGUGCACUUCUUuuucaguauc
((((.((.(((((((.(((((((..(.((((((.........).))))).)..))))).))))))))).)).))))..

Structure
--    u  u       u  -     uu u     - uuu 
  uacu aa gagaagu gc ccgug  u uuucg c   a
  |||| || ||||||| || |||||  | ||||| |   u
  auga uu UUCUUCA CG GGCGC  A AAAgc g   u
cu    c  u       -  U     UU C     a ugu 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression has been independently confirmed in mouse and rat [2].

Genome context
chr14: 101031987-101032064 [+]
Clustered miRNAs
18 other miRNAs are < 10 kb from hsa-mir-543
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-543 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-543

Accession MIMAT0004954
Description Homo sapiens hsa-miR-543 mature miRNA
Sequence 47 - AAACAUUCGCGGUGCACUUCUU - 68
Evidence experimental
RAKE [1]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298