MIR374B is a microRNA that has been studied in various contexts. It has been found that the expression of MIR374B is significantly attenuated in primed mesenchymal stem cells (MSCs) compared to naïve MSCs [PMC9509608]. In a network analysis, it was revealed that MIR374B, along with miR-944 and miR-374a, has a regulatory effect on the expression of chemokines such as Cxcl1, Ccl2, and Ccl7 [PMC5712098]. These microRNAs may be associated with the development of autoimmune-mediated arthritis by targeting these chemokines [PMC5712098]. MIR374B has also been found to be overexpressed in B cells in the Chinese population and has an inhibitory effect on chaperone proteins and suppressor genes, leading to increased B-cell proliferation and higher serum concentrations of poorly galactosylated IgA1 [PMC6834307]. In cancer research, it has been shown that MIR374B can directly target PD-1 and partially restore the function of exhausted T cells [PMC6833224]. Additionally, MIR374B levels were found to be low in atheroprotected sites but increased in endothelial cells at atheroprone regions [PMC6590197]. Furthermore, MIR374B has been associated with P-phase and improved survival with regorafenib treatment [PMC7376782] [PMC9589420]. In bladder cancer, MIR374B targets genes involved in cellular migration and invasion [PMC7783806]. Lastly, it was observed that MIR374B expression is significantly downregulated in Han Chinese individuals compared to Uyghurs in healthy skin samples [PMC7783806].
-- u AU c ac cggaugg AUAAUACAACCUGCUAAGUGu c || ||||||| ||||||||||||||||||||| ug gccugUU UAUUAUGUUGGACGAUUCacg u uc u AC a
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0004955 |
Description | Homo sapiens hsa-miR-374b-5p mature miRNA |
Sequence | 11 - AUAUAAUACAACCUGCUAAGUG - 32 |
Evidence |
experimental
cloned [2-3] |
Database links | |
Predicted targets |
Accession | MIMAT0004956 |
Description | Homo sapiens hsa-miR-374b-3p mature miRNA |
Sequence | 41 - CUUAGCAGGUUGUAUUAUCAUU - 62 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
|