WARNING: This summary was generated by AI. MIR760 is a microRNA that has been observed to have varying expression levels in different types of cancer, such as ovarian, liver, and colorectal cancers [PMC7462065]. The alteration in the expression of MIR760, whether it is overexpressed or underexpressed, has been implicated in the development of these cancers [PMC7462065]. Studies have shown that when MIR760 is suppressed or when its binding site is mutated, there is a notable increase in the levels of the ATXN1 protein [PMC7462065]. Since ATXN1 protein dysregulation is linked to neurodegenerative diseases, MIR760 may have a regulatory role in the expression of genes that are crucial in both oncogenesis and neurodegeneration [PMC7462065].
--g cg c u ucca c acc gcg ucgc cccc cag ccagagcc ggau u ||| |||| |||| ||| |||||||| |||| c cgu agcg GGGG GUC GGUCUCGG Cuua a caa aa A U --UG - aag
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004957 |
| Description | Homo sapiens hsa-miR-760 mature miRNA |
| Sequence | 49 - CGGCUCUGGGUCUGUGGGGA - 68 |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
|