MIR301B is a microRNA that has been studied in relation to its expression levels [PMC8109121]. In a study, the expressions of miR-454, miR301a, MIR301B, miR130a, and miR130b were normalized to U6 using the 2-ΔΔCt method [PMC8109121]. This method is commonly used to analyze gene expression levels. The study aimed to investigate the impact of BHLHE40/41 on the expression of MIR130B and MIR301B [PMC6659797]. BHLHE40/41 is a transcription factor that has been associated with various biological processes and diseases [PMC6659797]. By studying its influence on MIR130B and MIR301B expression, researchers aimed to gain insights into the regulatory mechanisms involved in microRNA expression [PMC6659797]. The findings of this study could potentially contribute to a better understanding of the roles played by microRNAs in cellular processes and disease development [PMC6659797]. Further research may be needed to fully elucidate the specific mechanisms by which BHLHE40/41 influences MIR130B and MIR301B expression [PMC6659797].
---g g C ---G A gugc cc cagguGCU UGACGA GUUGCACU CU u || |||||||| |||||| |||||||| || c gg gucuaCGA ACUGUU UAACGUGA ga u acca - A AUAG C agag
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Accession | MIMAT0004958 |
Description | Homo sapiens hsa-miR-301b-3p mature miRNA |
Sequence | 45 - CAGUGCAAUGAUAUUGUCAAAGC - 67 |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
Accession | MIMAT0032026 |
Description | Homo sapiens hsa-miR-301b-5p mature miRNA |
Sequence | 10 - GCUCUGACGAGGUUGCACUACU - 31 |
Evidence | not_experimental |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
|