WARNING: This summary was generated by AI. MIR216B, a microRNA, has been implicated in various cancer-related processes, including cell proliferation, migration, invasion, and chemosensitivity [PMC6504855]. It has been shown to be downregulated in colorectal cancer and its low expression is associated with poor patient prognosis [PMC6504855]. MIR216B is known to target oncogenic KRASG12D in pancreatic ductal adenocarcinoma cells and has been functionalized on the surface of liposomes to improve cell penetration [PMC9683052]. It also interacts with the long non-coding RNA MALAT1 in hepatocellular carcinoma (HCC) cells, where its levels inversely correlate with MALAT1 expression; both MIR216B mimics and MALAT1-siRNA can inhibit autophagy and increase apoptosis when chemoresistance is present [PMC6504855]. Additionally, MIR216B can be sponged by lncPVT1 to inhibit Beclin-1 expression and induce cisplatin tolerance by regulating apoptosis and autophagy in non-small cell lung cancer (NSCLC) cells [PMC9373174]. Furthermore, MIR216B modulates the PIK3CA/AKT/MTOR signaling pathway through its interaction with SNHG7 lncRNA which sponges MIR216B to promote colorectal cancer cell migration and invasion by increasing GALNT1 levels [PMC6912041], [PMC9482270]. In breast cancer models, overexpression of MIR216B resulted in a moderate tumor suppressive effect but significantly reduced pulmonary metastasis [PMC3912413].
--g gaA A C --A g ac cagacug AAUCUCUGC GG AA UGUGAu uc u ||||||| ||||||||| || || |||||| || gucugac UUAGAGAUG CC UU ACAcua ag g aca AUC C A CAC a ga
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0004959 |
| Description | Homo sapiens hsa-miR-216b-5p mature miRNA |
| Sequence | 11 - AAAUCUCUGCAGGCAAAUGUGA - 32 |
| Evidence |
experimental
cloned [2], Illumina [3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0026721 |
| Description | Homo sapiens hsa-miR-216b-3p mature miRNA |
| Sequence | 49 - ACACACUUACCCGUAGAGAUUCUA - 72 |
| Evidence |
experimental
Illumina [3] |
|