miRBase entry: hsa-mir-208b

Stem-loop hsa-mir-208b


Accession
MI0005570
Symbol
HGNC: MIR208B
Description
Homo sapiens hsa-mir-208b precursor miRNA mir-208
Gene
family?
RF00749; mir-208

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR208B is a microRNA that is encoded within the intron of the MYH7 gene, which codes for the slow isoform of Myosin Heavy Chain (MyHC). It has been shown to play a role in regulating mitochondrial function and metabolism in cooperation with KLF4, ESRR, and PGC-1 [PMC5586433]. MIR208B is differentially expressed in a sex- and hypertrophy-dependent manner, with an increase reported in hypertrophy [PMC5586433]. It is generated from an intron of Myh7, which is the cardiac fetal isoform that switches to Myh6 after birth [PMC5586433]. MIR208B has been implicated in the regulation of skeletal muscle fiber type switch to Myh7 through its interaction with PPARα and ESRRG [PMC7123062]. It has also been associated with cardiac hypertrophy and its downregulation has been observed in patients with amyotrophic lateral sclerosis (ALS) [PMC5573384] [PMC8424364]. MIR208B has been shown to target genes such as Sox6, Sp3, Thrap1, EZH2, EED, and SUZ12 [PMC4488424] [PMC4754821]. Additionally, changes in MIR208B expression have been observed during muscle atrophy and cancer cachexia [PMC8260947] [PMC8396502]. The role of MIR208B in regulating muscle regeneration and differentiation can be influenced by essential amino acid intake [PMC8466275]. Plasma levels of MIR208B have also been found to be elevated by cardiovascular damage [PMC3157373]

Literature search
101 open access papers mention hsa-mir-208b
(409 sentences)

Sequence

2570 reads, 312 reads per million, 14 experiments
ccucucagggAAGCUUUUUGCUCGAAUUAUGUuucugauccgaauAUAAGACGAACAAAAGGUUUGUcugagggcag
.((((((((.((((((((((.(((..((((((((.......))))))))..))).)))))))))).))))))))...

Structure
--c        g          C   AA        cu 
   cucucagg AAGCUUUUUG UCG  UUAUGUuu  g
   |||||||| |||||||||| |||  ||||||||  a
   gggagucU UUUGGAAAAC AGC  AAUAuaag  u
gac        G          A   AG        cc 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
chr14: 23417987-23418063 [-]

Disease association
hsa-mir-208b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-208b-3p

Accession MIMAT0004960
Description Homo sapiens hsa-miR-208b-3p mature miRNA
Sequence 46 - AUAAGACGAACAAAAGGUUUGU - 67
Evidence experimental
cloned [2], Illumina [3]
Database links
Predicted targets

Mature hsa-miR-208b-5p

Accession MIMAT0026722
Description Homo sapiens hsa-miR-208b-5p mature miRNA
Sequence 11 - AAGCUUUUUGCUCGAAUUAUGU - 32
Evidence experimental
Illumina [3]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298

  3. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45