miRBase entry: hsa-mir-208b

Stem-loop hsa-mir-208b


Accession
MI0005570
Symbol
HGNC: MIR208B
Description
Homo sapiens hsa-mir-208b precursor miRNA mir-208
Gene
family?
RF00749; mir-208

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR208B is a microRNA encoded by an intron of the Myh7 gene, which is associated with the fetal isoform of myosin heavy chain in the heart [PMC5586433]. It exhibits sex- and hypertrophy-dependent differences in expression, with an increase in MIR208B levels reported during hypertrophy [PMC5586433]. While miR208a is involved in the switch from Myh6 to Myh7 during cardiac stress and hypothyroidism, the role of MIR208B in this process is not explicitly mentioned [PMC5586433]. The regulation of MIR208B is complex; it is activated by ESRRG and inhibited by PPARα, which influences the expression of Myh7 [PMC5586433]. MIR208B serves as a potential diagnostic and prognostic marker in pathological conditions such as atherosclerosis and acute coronary syndrome (ACS) [PMC7123062]. It contributes to cardiac hypertrophy by downregulating MYH6 and upregulating MYH7 expression [PMC7123062]. Additionally, MIR208B has been implicated in skeletal muscle fiber type switch by repressing genes such as Sox6 through post-transcriptional degradation mechanisms [PMC4488424], and this may contribute to muscle plasticity during atrophy or disease progression such as ALS [PMC8260947; PMC5573384]..

Literature search
101 open access papers mention hsa-mir-208b
(409 sentences)

Sequence

2570 reads, 312 reads per million, 14 experiments
ccucucagggAAGCUUUUUGCUCGAAUUAUGUuucugauccgaauAUAAGACGAACAAAAGGUUUGUcugagggcag
.((((((((.((((((((((.(((..((((((((.......))))))))..))).)))))))))).))))))))...

Structure
--c        g          C   AA        cu 
   cucucagg AAGCUUUUUG UCG  UUAUGUuu  g
   |||||||| |||||||||| |||  ||||||||  a
   gggagucU UUUGGAAAAC AGC  AAUAuaag  u
gac        G          A   AG        cc 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence was identified as a miRNA candidate by Berezikov et al. using RAKE and MPSS techniques [1]. Expression was later confirmed by cloning [2].

Genome context
chr14: 23417987-23418063 [-]

Disease association
hsa-mir-208b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-208b-3p

Accession MIMAT0004960
Description Homo sapiens hsa-miR-208b-3p mature miRNA
Sequence 46 - AUAAGACGAACAAAAGGUUUGU - 67
Evidence experimental
cloned [2], Illumina [3]
Database links
Predicted targets

Mature hsa-miR-208b-5p

Accession MIMAT0026722
Description Homo sapiens hsa-miR-208b-5p mature miRNA
Sequence 11 - AAGCUUUUUGCUCGAAUUAUGU - 32
Evidence experimental
Illumina [3]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298

  3. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45