WARNING: This summary was generated by AI. MIR208B is a microRNA encoded by an intron of the Myh7 gene, which is associated with the fetal isoform of myosin heavy chain in the heart [PMC5586433]. It exhibits sex- and hypertrophy-dependent differences in expression, with an increase in MIR208B levels reported during hypertrophy [PMC5586433]. While miR208a is involved in the switch from Myh6 to Myh7 during cardiac stress and hypothyroidism, the role of MIR208B in this process is not explicitly mentioned [PMC5586433]. The regulation of MIR208B is complex; it is activated by ESRRG and inhibited by PPARα, which influences the expression of Myh7 [PMC5586433]. MIR208B serves as a potential diagnostic and prognostic marker in pathological conditions such as atherosclerosis and acute coronary syndrome (ACS) [PMC7123062]. It contributes to cardiac hypertrophy by downregulating MYH6 and upregulating MYH7 expression [PMC7123062]. Additionally, MIR208B has been implicated in skeletal muscle fiber type switch by repressing genes such as Sox6 through post-transcriptional degradation mechanisms [PMC4488424], and this may contribute to muscle plasticity during atrophy or disease progression such as ALS [PMC8260947; PMC5573384]..
--c g C AA cu cucucagg AAGCUUUUUG UCG UUAUGUuu g |||||||| |||||||||| ||| |||||||| a gggagucU UUUGGAAAAC AGC AAUAuaag u gac G A AG cc
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0026722 |
| Description | Homo sapiens hsa-miR-208b-5p mature miRNA |
| Sequence | 11 - AAGCUUUUUGCUCGAAUUAUGU - 32 |
| Evidence |
experimental
Illumina [3] |
| Accession | MIMAT0004960 |
| Description | Homo sapiens hsa-miR-208b-3p mature miRNA |
| Sequence | 46 - AUAAGACGAACAAAAGGUUUGU - 67 |
| Evidence |
experimental
cloned [2], Illumina [3] |
| Database links |
|
| Predicted targets |
|
|