miRBase entry: ppt-MIR167

Stem-loop ppt-MIR167


Accession
MI0005661
Description
Physcomitrella patens ppt-MIR167 precursor miRNA

Literature search
2 open access papers mention ppt-MIR167
(3 sentences)

Sequence


accaaaaguuGGAAGCUGCCAGCAUGAUCCUuuaacuuuucuagagggaaagaucagaucaucuggcugcuuucauccuguu
......((.(((((((.(((((.((((((((((..((((...))))..))))....))))))))))).)))))))..))...

Structure
accaaa  -u       U     C      ----    aa    u 
      ag  uGGAAGC GCCAG AUGAUC    CUuu  cuuu  
      ||  ||||||| ||||| ||||||    ||||  |||| c
      uc  acuuucg cgguc uacuag    gaaa  gaga  
---uug  cu       u     -      acua    gg    u 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
Unknown

Database links

Mature ppt-miR167

Accession MIMAT0004353
Description Physcomitrella patens ppt-miR167 mature miRNA
Sequence 11 - GGAAGCUGCCAGCAUGAUCCU - 31
Evidence not_experimental

References

  1. PubMed ID: 17359535
    Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution
    Fattash I, Voss B, Reski R, Hess WR, Frank W
    BMC Plant Biol (2007) 7:13