miRBase entry: ppt-MIR419

Stem-loop ppt-MIR419


Accession
MI0005670
Description
Physcomitrella patens ppt-MIR419 precursor miRNA

Literature search
1 open access papers mention ppt-MIR419
(1 sentences)

Sequence


gguugccuguguuaguuauaguucuaaccguaaguccacgucggaggaggcUGAUGAAUGAUGACGAUGUAUaggccuaucu
(((.(((((((...(((((.((((...((.....(((.....)))...)).....)))).)))))....)))))))..))).

Structure
-   -u       -uua     a    --uaa  guaag   a 
 ggu  gccugug    guuau guuc     cc     ucc c
 |||  |||||||    ||||| ||||     ||     ||| g
 cua  cggaUAU    CAGUA UAAG     gg     agg u
u   uc       GUAG     G    UAGUc  --agg   c 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
The status of this sequence as a miRNA has been questioned on the basis of lack of conservation in genomes other than Arabidopsis and rice, moderately poor precursor hairpin structure, lack of identified targets, and low Northern blot signal [2]. This sequence may therefore be removed in subsequent data releases.

Genome context
Chr06: 8028394-8028475 [-]

Database links

Mature ppt-miR419

Accession MIMAT0004358
Description Physcomitrella patens ppt-miR419 mature miRNA
Sequence 52 - UGAUGAAUGAUGACGAUGUAU - 72
Evidence experimental
Northern [1]

References

  1. PubMed ID: 16669754
    MicroRNAS and their regulatory roles in plants
    "Jones-Rhoades MW, Bartel DP, Bartel B"
    "Annu Rev Plant Biol (2006) 57:19-53

  2. PubMed ID: 17359535
    Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution
    Fattash I, Voss B, Reski R, Hess WR, Frank W
    BMC Plant Biol (2007) 7:13