miRBase entry: ppt-MIR477g

Stem-loop ppt-MIR477g


Accession
MI0005674
Description
Physcomitrella patens ppt-MIR477g precursor miRNA

Literature search
1 open access papers mention ppt-MIR477g
(11 sentences)

Sequence


guguucguuuuucUCCCUCAAAGGCUUCCAACAAcagucggaauuaacucugaugcggccauuaucacugguugcagugaauuauucuaguucugcuGUUGGAAGCCUUCGUGGGAGAcgaaagaacc
..((((.(((.((((((.(.(((((((((((((.(((..(((((.((.((...((((((((.......))))))))..)).)))))))....))).))))))))))))).).)))))).))).)))).

Structure
gu    g   u      U A             A   --uc     u  c  uga        uu 
  guuc uuu ucUCCC C AAGGCUUCCAACA cag    ggaau aa uc   ugcggcca  a
  |||| ||| |||||| | ||||||||||||| |||    ||||| || ||   ||||||||  u
  caag aag AGAGGG G UUCCGAAGGUUGu guc    ucuua uu ag   acguuggu  c
-c    a   c      U C             c   uuga     -  a  -ug        ca 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
Talmor-Neiman et al. reported a mature miRNA derived from the 3' arm of this hairpin, and named it miR1213 [1]. A mature miRNA from the 5' arm was named miR477b [2]. Names of the miR477 family are rationalised in [3]. The mature sequences shown here are the most abundant clones by deep-sequencing [3].

Genome context
Chr22: 2647177-2647304 [-]

Database links

Mature ppt-miR477g-5p

Accession MIMAT0004362
Description Physcomitrella patens ppt-miR477g-5p mature miRNA
Sequence 14 - UCCCUCAAAGGCUUCCAACAA - 34
Evidence experimental
Northern [2], 454 [3], cloned [3]

Mature ppt-miR477g-3p

Accession MIMAT0003902
Description Physcomitrella patens ppt-miR477g-3p mature miRNA
Sequence 98 - GUUGGAAGCCUUCGUGGGAGA - 118
Evidence experimental
Northern [1], cloned [2], 454 [3]

References

  1. PubMed ID: 17359535
    Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution
    Fattash I, Voss B, Reski R, Hess WR, Frank W
    BMC Plant Biol (2007) 7:13

  2. PubMed ID: 17601824
    Common functions for diverse small RNAs of land plants
    "Axtell MJ, Snyder JA, Bartel DP"
    "Plant Cell (2007) 19:1750-1769

  3. PubMed ID: 16824179
    Novel micro-RNAs and intermediates of micro-RNA biogenesis from moss
    "Talmor-Neiman M, Stav R, Frank W, Voss B, Arazi T"
    "Plant J (2006) 47:25-37