miRBase entry: hsa-mir-1179

Stem-loop hsa-mir-1179


Accession
MI0006272
Symbol
HGNC: MIR1179
Description
Homo sapiens hsa-mir-1179 precursor miRNA mir-1179
Gene
family?
RF03469; mir-1179

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR1179 is a microRNA (miRNA) that has been identified as a novel locus associated with thyroid-stimulating hormone (TSH) regulation [PMC3567175]. It was found to have a significant association with TSH levels (P = 2.89×10−10) [PMC3567175]. The TSH-elevating allele of MIR1179 was associated with decreasing levels of free thyroxine (FT4) [PMC3567175]. MIR1179 is expressed in various tissues, including the thyroid, brain, and blood [PMC3567175]. The exact biological mechanisms and specific genes involved in the regulation of TSH by MIR1179 are not yet fully understood and require further investigation [PMC3567175].

MIR1179 has also been implicated in other biological processes. It has been shown to interact with hsa_circ_0000652 and OX40L mRNA, as demonstrated by the enrichment of these targets using biotin-labeled hsa-miR-1179 probes [PMC8716807]. Additionally, MIR1179 has been found to be up-regulated in non-functioning adenomas due to lower methylation rates, along with other genes such as CACNA2D4, GRIA2, miR4774, and LINC01351 [PMC7652879].

Furthermore, TargetScan analysis has validated biological targets for MIR1179 [PMC8572446].

In conclusion, MIR1179 is a miRNA that plays a role in TSH regulation and is expressed in various tissues. Its exact mechanisms of action and specific gene targets require further investigation. Additionally, it has been implicated in other biological processes such as adenoma development and target mRNA interactions.

Literature search
3 open access papers mention hsa-mir-1179
(5 sentences)

Sequence

736 reads, 25 reads per million, 59 experiments
ggcuggaaaggaagAAGCAUUCUUUCAUUGGUUGGuguguauugccuugucaaccaauaagaggaugccauuuauccuuuucugacuagcu
((((((((((((.((((((((((((.(((((((((...(......)...))))))))).)))))))))..))).)))))).....))))))

Structure
      -----      a   --         C         ugu ua 
ggcugg     aaagga gAA  GCAUUCUUU AUUGGUUGG   g  u
||||||     |||||| |||  ||||||||| |||||||||   |   
ucgauc     uuuccu uuu  cguaggaga uaaccaacu   c  u
      agucu      a   ac         a         guu cg 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr15: 88608107-88608197 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-1179
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-1179 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-1179

Accession MIMAT0005824
Description Homo sapiens hsa-miR-1179 mature miRNA
Sequence 15 - AAGCAUUCUUUCAUUGGUUGG - 35
Evidence experimental
cloned [1]
Database links
Predicted targets

References

  1. PubMed ID: 17922033
    MicroRNA expression signature of human sarcomas
    "Subramanian S, Lui WO, Lee CH, Espinosa I, Nielsen TO, Heinrich MC, Corless CL, Fire AZ, van de Rijn M"
    "Oncogene (2008) 27:2015-2026