Hsa-mir-1227 is a differentially regulated miRNA that has been identified in various studies as a potential biomarker for prognosis, diagnosis, and treatment of liver diseases, articular cartilage conditions, and cancer recurrence [PMC7582243] [PMC3495209] [PMC5759858]. It has been found to be involved in the regulation of MECP2 expression and activity, epigenetic regulation of gene expression, degradation of the extracellular matrix, peroxisomal protein import [PMC7582243]. Hsa-mir-1227 has also been associated with metastatic behaviors in breast cancer and gastric cancer [PMC3495209]. Additionally, it has been shown to enhance migration of cancer-associated fibroblasts and is abundant in large oncosomes [PMC3495209]. Hsa-mir-1227 has been validated as a target for hsa-miR-10b and hsa-miR-146b-3p in different studies [PMC5759858]. Furthermore, it is one of the miRNAs that have shown significant correlation with recurrence in osteosarcoma [PMC5759858]. The predicted targets regulated by hsa-mir-1227 include a high number of transcription proteins as well as secretory, membrane, surface or receptor proteins [PMC3495209]. References: [PMC7582243] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7582243/ [PMC3495209] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3495209/ [PM5759858] - https://www.ncbi.nlm.nih.gov/pmc/articles/PM5759858/
G CC C gggcacugcuggggugggcacagcagccaugcaga cau UGGGG AGG GGUGGu gcggg u ||||| ||| |||||| ||||| ACCCC UUC CCACCG UGCcc u G UU - ----------------------------------- cag
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0005580 |
Description | Homo sapiens hsa-miR-1227-3p mature miRNA |
Sequence | 69 - CGUGCCACCCUUUUCCCCAG - 88 |
Evidence |
experimental
cloned [1] |
Database links | |
Predicted targets |
Accession | MIMAT0022941 |
Description | Homo sapiens hsa-miR-1227-5p mature miRNA |
Sequence | 1 - GUGGGGCCAGGCGGUGG - 17 |
Evidence | not_experimental |
|