hsa-mir-1227 is a microRNA implicated in various biological processes and diseases, including liver diseases and cancer. It has been identified as a differentially regulated miRNA in patients with liver diseases, classified by the Child-Pugh score, suggesting its potential as a biomarker for prognosis, diagnosis, and treatment [PMC7582243]. Additionally, hsa-mir-1227 is suggested to play a role in the regulation of articular cartilage, indicating its relevance in other tissues [PMC3495209]. Pathway analysis has revealed that hsa-mir-1227 is involved in the regulation of MECP2 expression and activity as well as the degradation of the extracellular matrix [PMC7582243]. In cancer research, hsa-mir-1227 has been found to enhance the migration of cancer-associated fibroblasts and is abundant in large oncosomes [PMC5759858]. While it has been identified as a target for other miRNAs such as hsa-miR-10b, the association with osteosarcoma recurrence mentioned in the original summary is not directly linked to hsa-mir-1227 [PMC5759858]. Furthermore, hsa-mir-1227 regulates a significant proportion of transcription proteins that are putative mRNA targets [PMC3495209]. This evidence collectively suggests that hsa-mir-1227 could serve as an important biomarker and therapeutic target across various diseases.
G CC C gggcacugcuggggugggcacagcagccaugcaga cau UGGGG AGG GGUGGu gcggg u ||||| ||| |||||| ||||| ACCCC UUC CCACCG UGCcc u G UU - ----------------------------------- cag
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0005580 |
| Description | Homo sapiens hsa-miR-1227-3p mature miRNA |
| Sequence | 69 - CGUGCCACCCUUUUCCCCAG - 88 |
| Evidence |
experimental
cloned [1] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0022941 |
| Description | Homo sapiens hsa-miR-1227-5p mature miRNA |
| Sequence | 1 - GUGGGGCCAGGCGGUGG - 17 |
| Evidence | not_experimental |
|