miRBase entry: hsa-mir-663b

Stem-loop hsa-mir-663b


Accession
MI0006336
Symbol
HGNC: MIR663B
Description
Homo sapiens hsa-mir-663b precursor miRNA mir-663
Gene
family?
RF00957; mir-663

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR663B is a down-regulated microRNA located in the intron of ANKDR30BL, and it is associated with various biological processes and diseases. In Immunity-H, genes such as SPRR3, CTGF, E2F5, MIR663B, and others have significantly higher mutation rates compared to Immunity-L [PMC9855412]. Previous studies have shown that silencing or knockout of POLRMT, a gene with higher mutation rates in Immunity-H, can inhibit cell proliferation and promote apoptosis [PMC9855412]. In patients with down-regulated MIR663B expression, there is a significant increase in the expression of genes associated with cell proliferation and migration [PMC7439310]. MIR663B has been found to regulate the expression of CCL17, CD40, and PIK3CD in chronic lymphocytic leukemia [PMC7439310]. Additionally, high expression of MIR663B is correlated with distant metastasis and advanced tumor grading in endometrial cancer patients [PMC5796233]. In endometrial cancer cells, PS suppresses MIR663B expression which plays an oncogenic role by upregulating pro-survival Bcl-2 and reducing apoptosis [PMC5796233]. The gene cluster on chromosome 2 contains an area between RNA5-8SP5 and MIR663B genes that includes Exp-MiBRs [PMC6792129]. Although there was no significant change in the expression of any miRNAs over time, there was a trend for an increase in MIR663B expression [PMC6416171].

Literature search
66 open access papers mention hsa-mir-663b
(264 sentences)

Sequence

140 reads, 74 reads per million, 45 experiments
ggugccgagggccguccggcauccuaggcgggucgcugcgguaccucccuccugucuguggcggugggaucccguggccguguuuuccuGGUGGCCCGGCCGUGCCUGAGGuuuc
...(((..((((((.((((..(((((((((.(..(((((((....((((.((.(((...))))).))))..)))))))).))....))))).)).)))).)).))))..)))...

Structure
ggu   ga    -  u    ca  -     ----  g uc       uacc    u  u   u 
   gcc  gggc cg ccgg  uc cuagg    cg g  gcugcgg    uccc cc guc  
   |||  |||| || ||||  || |||||    || |  |||||||    |||| || ||| g
   uGG  UCCG GC GGCC  GG GGucc    gu c  cggugcc    aggg gg cgg  
cuu   AG    U  C    -C  U     uuuu  g --       --cu    u  -   u 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr2: 132256966-132257080 [-]

Disease association
hsa-mir-663b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-663b

Accession MIMAT0005867
Description Homo sapiens hsa-miR-663b mature miRNA
Sequence 90 - GGUGGCCCGGCCGUGCCUGAGG - 111
Evidence experimental
miRAP [1]
Database links
Predicted targets

References

  1. PubMed ID: 17989710
    MicroRNA expression profiles of human leukemias
    "Takada S, Yamashita Y, Berezikov E, Hatanaka H, Fujiwara SI, Kurashina K, Watanabe H, Enomoto M, Soda M, Choi YL, Mano H"
    "Leukemia (2008) 22:1274-1278