miRBase entry: hsa-mir-1247

Stem-loop hsa-mir-1247


Accession
MI0006382
Symbol
HGNC: MIR1247
Description
Homo sapiens hsa-mir-1247 precursor miRNA mir-1247
Gene
family?
RF03271; mir-1247

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR1247 is a microRNA that has been found to be dense in primary gastric cancer tissue but not in normal gastric cancer tissue [PMC9476644]. It has been shown that MIR1247, along with mir941, is silenced by DNA methylation in multiple gastric cancer cell lines [PMC9476644]. These microRNAs are regulated by gastric cancer DNA methylation transcription and have the ability to inhibit gastric cancer by inhibiting oncogenes [PMC9476644]. In a study comparing tumor tissue to adjacent nontumor tissue, the expression of MIR1247 was not increased in the tumor tissue [PMC7590111]. Inhibitors of MIR1247 have been shown to decrease cell viability across all cell lines [PMC7590111]. PCNXL3 is a gene that has been found to have a high correlation with colon adenocarcinoma and is one of the genes associated with hyper-methylated DMRs along with MIR1247 [PMC5986643]. The regulation of MIR941 and MIR1247 has been associated with gastric cancer cell growth and migration [PMC7541134]. In diabetes, expression changes of MIR1247 were not significantly returned to normal levels by treatment [PMC5114726]. It has been observed that MIR1247 may have different targets in various types of malignancies [PMC5966945]. Stable expression of MIR1247 was achieved through puromycin selection in infected cells, and its methylation levels were decreased by DAC exposure leading to increased expression [PMC6251029].

Literature search
20 open access papers mention hsa-mir-1247
(147 sentences)

Sequence

1835 reads, 203 reads per million, 87 experiments
ccgcuugccucgcccagcgcagccccggccgcugggcgcACCCGUCCCGUUCGUCCCCGGAcguugcucucuaCCCCGGGAACGUCGAGACUGGAGCgcccgaacugagccaccuucgcggaccccgagagcggcg
.((((.((((((.((.(((.((....(((((.(((((((.((.(((.((..(((.(((((..((........)).))))).))).)).))).)).)))))))...)).)))..)).)))))....)))).))))))

Structure
c    u  -    ---c  a   c  cccc   -  --c       A  C   C  UU   C     Ac  ugc 
 cgcu gc cucg    cc gcg ag    ggc cg   ugggcgc CC GUC CG  CGU CCCGG  gu   u
 |||| || ||||    || ||| ||    ||| ||   ||||||| || ||| ||  ||| |||||  ||    
 gcgg cg gagc    gg cgc uc    ccg gu   gcccgCG GG CAG GC  GCA GGGCC  Ca   c
-    -  a    ccca  -   u  --ca   a  caa       A  U   A  -U   A     -C  ucu 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr14: 101560287-101560422 [-]

Disease association
hsa-mir-1247 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-1247-5p

Accession MIMAT0005899
Description Homo sapiens hsa-miR-1247-5p mature miRNA
Sequence 40 - ACCCGUCCCGUUCGUCCCCGGA - 61
Evidence experimental
Illumina [1]
Database links
Predicted targets

Mature hsa-miR-1247-3p

Accession MIMAT0022721
Description Homo sapiens hsa-miR-1247-3p mature miRNA
Sequence 74 - CCCCGGGAACGUCGAGACUGGAGC - 97
Evidence not_experimental
Database links
Predicted targets

References

  1. PubMed ID: 18285502
    Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells
    "Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA"
    "Genome Res (2008) 18:610-621