miRBase entry: hsa-mir-1322

Stem-loop hsa-mir-1322


Accession
MI0006653
Symbol
HGNC: MIR1322
Description
Homo sapiens hsa-mir-1322 precursor miRNA

Literature search
3 open access papers mention hsa-mir-1322
(30 sentences)

Sequence

17 reads, 1 reads per million, 8 experiments
aguaucaugaauuagaaaccuacuuauuacauaguuuacauaagaagcguGAUGAUGCUGCUGAUGCUGua
((((((((((((((.................))))))).......(((((....)))))..)))))))...

Structure
---       ugaauuagaaaccuacuuauuacauaguuuacauaaga     G 
   aguauca                                      agcgu A
   |||||||                                      |||||  
   UCGUAGU                                      UCGUA U
auG       ------------------------------------CG     G 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
Afanasyeva et al. refer to this sequence using the internal identifier MYCNSC_NB2_237 [1]. Some additional sequences reported in [1] do not meet miRBase requirements for miRNA identification.

Genome context
chr8: 10825373-10825443 [-]

Disease association
hsa-mir-1322 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-1322

Accession MIMAT0005953
Description Homo sapiens hsa-miR-1322 mature miRNA
Sequence 51 - GAUGAUGCUGCUGAUGCUG - 69
Evidence experimental
cloned [1]

References

  1. PubMed ID: 18230126
    New miRNAs cloned from neuroblastoma
    "Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F"
    "BMC Genomics (2008) 9:52