miRBase entry: mml-mir-26b

Stem-loop mml-mir-26b


Accession
MI0007594
Description
Macaca mulatta mml-mir-26b precursor miRNA mir-26
Gene
family?
RF00244; mir-26

Literature search
1 open access papers mention mml-mir-26b
(2 sentences)

Sequence

72720 reads, 553 reads per million, 8 experiments
ccgggacccagUUCAAGUAAUUCAGGAUAGGUugugugcuguccagCCUGUUCUCCAUUACUUGGCUcggggaccgg
((((..((((((.((((((((..(((((((((((.(......))))))))))))..))))))))))).)))..))))

Structure
    ga   -   U        UC           u ug 
ccgg  ccc agU CAAGUAAU  AGGAUAGGUug g  c
||||  ||| ||| ||||||||  ||||||||||| |   
ggcc  ggg UCG GUUCAUUA  UCUUGUCCgac c  u
    ag   c   -        CC           - ug 


Annotation confidence Medium
Do you think this miRNA is real?

Genome context
chr12: 100509522-100509598 [+]

Database links

Mature mml-miR-26b-5p

Accession MIMAT0006166
Description Macaca mulatta mml-miR-26b-5p mature miRNA
Sequence 12 - UUCAAGUAAUUCAGGAUAGGU - 32
Evidence experimental
Illumina [2]
Database links
Predicted targets

Mature mml-miR-26b-3p

Accession MIMAT0026801
Description Macaca mulatta mml-miR-26b-3p mature miRNA
Sequence 47 - CCUGUUCUCCAUUACUUGGCU - 67
Evidence experimental
Illumina [2]

References

  1. PubMed ID: 18186931
    Identification of novel homologous microRNA genes in the rhesus macaque genome
    Yue J, Sheng Y, Orwig KE
    BMC Genomics (2008) 9:8

  2. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45