miRBase entry: cel-mir-1819

Stem-loop cel-mir-1819


Accession
MI0007981
Description
Caenorhabditis elegans cel-mir-1819 precursor miRNA

Literature search
2 open access papers mention cel-mir-1819
(2 sentences)

Sequence

3438 reads, 25 reads per million, 16 experiments
aaucagugaucAAUCAUGCUCAAAACAUUCGACAuaacuuaauuucuuugUGGAAUGAUUGAGCUUGAUGGAucgaugaaa
..(((.(((((.((((.((((((..(((((.(((..............))).))))).)))))).)))).))))).)))..

Structure
aa   g     A    U      AA     G   uaacuu 
  uca ugauc AUCA GCUCAA  CAUUC ACA      a
  ||| ||||| |||| ||||||  ||||| |||       
  agu gcuAG UAGU CGAGUU  GUAAG Ugu      a
aa   a     G    U      -A     G   uucuuu 


Annotation confidence Low
Do you think this miRNA is real?
Comments
This sequence was erroneously named mir-804 in [1].

Genome context
chrX: 16207955-16208035 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from cel-mir-1819
Name Accession Chromosome Start End Strand Confidence




Database links

Mature cel-miR-1819-3p

Accession MIMAT0006586
Description Caenorhabditis elegans cel-miR-1819-3p mature miRNA
Sequence 51 - UGGAAUGAUUGAGCUUGAUGGA - 72
Evidence experimental
454 [1], Illumina [2-3]
Database links
Predicted targets

Mature cel-miR-1819-5p

Accession MIMAT0020358
Description Caenorhabditis elegans cel-miR-1819-5p mature miRNA
Sequence 12 - AAUCAUGCUCAAAACAUUCGACA - 34
Evidence experimental
Illumina [3]

References

  1. PubMed ID: 19460142
    Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development
    Kato M, de Lencastre A, Pincus Z, Slack FJ
    Genome Biol (2009) 10:R54

  2. PubMed ID: 18042455
    Systematic identification of C. elegans miRISC proteins, miRNAs, and mRNA targets by their interactions with GW182 proteins AIN-1 and AIN-2
    "Zhang L, Ding L, Cheung TH, Dong MQ, Chen J, Sewell AK, Liu X, Yates JR 3rd, Han M"
    "Mol Cell (2007) 28:598-613

  3. PubMed ID: 21307183
    Improved annotation of C. elegans microRNAs by deep sequencing reveals structures associated with processing by Drosha and Dicer
    "Warf MB, Johnson WE, Bass BL"
    "RNA (2011) 17:563-577