miRBase entry: ath-MIR1887

Stem-loop ath-MIR1887


Accession
MI0008304
Description
Arabidopsis thaliana ath-MIR1887 precursor miRNA


Sequence


uuguucacuuagauuguucuuaguaugagguguucucgUACUAAGUAGAGUCUAAGAGAacaa
.(((((.((((((((.(.(((((((((((.....))))))))))).).)))))))).))))).

Structure
u     a        g u           g 
 uguuc cuuagauu u cuuaguaugag u
 ||||| |||||||| | ||||||||||| g
 acaAG GAAUCUGA A GAAUCAUgcuc u
a     A        G U           u 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr4: 11370263-11370325 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from ath-MIR1887
Name Accession Chromosome Start End Strand Confidence




Database links

Mature ath-miR1887

Accession MIMAT0007854
Description Arabidopsis thaliana ath-miR1887 mature miRNA
Sequence 39 - UACUAAGUAGAGUCUAAGAGA - 59
Evidence experimental
PARE [1]

References

  1. PubMed ID: 18542052
    Global identification of microRNA-target RNA pairs by parallel analysis of RNA ends
    "German MA, Pillay M, Jeong DH, Hetawal A, Luo S, Janardhanan P, Kannan V, Rymarquis LA, Nobuta K, German R, De Paoli E, Lu C, Schroth G, Meyers BC, Green PJ"
    "Nat Biotechnol (2008) 26:941-946