miRBase entry: hsa-mir-1910

Stem-loop hsa-mir-1910


Accession
MI0008331
Symbol
HGNC: MIR1910
Description
Homo sapiens hsa-mir-1910 precursor miRNA mir-1910
Gene
family?
RF03911; mir-1910

Literature search
2 open access papers mention hsa-mir-1910
(2 sentences)

Sequence

164 reads, 3 reads per million, 38 experiments
ugucccuucagCCAGUCCUGUGCCUGCCGCCUuugugcuguccuuggaggGAGGCAGAAGCAGGAUGACAaugagggcaa
((.((((.((....(((((((..(((((.(((((............))))).)))))..))))))).....)))))))).

Structure
-  u    u  -gCCA       GC     G     gugcu 
 ug cccu ca     GUCCUGU  CUGCC CCUuu     g
 || |||| ||     |||||||  ||||| |||||      
 ac ggga gu     UAGGACG  GACGG Gggag     u
a  -    -  aACAG       AA     A     guucc 


Annotation confidence Medium
Do you think this miRNA is real?

Genome context
chr16: 85741621-85741700 [-]

Disease association
hsa-mir-1910 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-1910-5p

Accession MIMAT0007884
Description Homo sapiens hsa-miR-1910-5p mature miRNA
Sequence 12 - CCAGUCCUGUGCCUGCCGCCU - 32
Evidence experimental
454 [1]
Database links
Predicted targets

Mature hsa-miR-1910-3p

Accession MIMAT0026917
Description Homo sapiens hsa-miR-1910-3p mature miRNA
Sequence 51 - GAGGCAGAAGCAGGAUGACA - 70
Evidence experimental
Illumina [2]
Database links
Predicted targets

References

  1. PubMed ID: 18583537
    MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries
    "Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M"
    "Stem Cells (2008) 26:2496-2505

  2. PubMed ID: 23226537
    The repertoire and features of human platelet microRNAs
    Plé H, Landry P, Benham A, Coarfa C, Gunaratne PH, Provost P
    PLoS One (2012) 7:e50746