miRBase entry: hsa-mir-1911

Stem-loop hsa-mir-1911


Accession
MI0008332
Symbol
HGNC: MIR1911
Description
Homo sapiens hsa-mir-1911 precursor miRNA mir-1911
Gene
family?
RF03268; mir-1911

Literature search
3 open access papers mention hsa-mir-1911
(3 sentences)

Sequence

248 reads, 2 reads per million, 12 experiments
ucggcaucugcUGAGUACCGCCAUGUCUGUUGGGcauccacagucuccCACCAGGCAUUGUGGUCUCCgcugacgcuuug
..(((.((.((.(((.(((((.(((((((.((((...(....)...)))).))))))).)))))))).)).)).)))...

Structure
-uc   a  u  U   U     C       U    cau c 
   ggc uc gc GAG ACCGC AUGUCUG UGGG   c a
   ||| || || ||| ||||| ||||||| ||||   |  
   ucg ag cg CUC UGGUG UACGGAC ACcc   g c
guu   c  u  C   -     U       C    ucu a 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chrX: 114763184-114763263 [+]

Disease association
hsa-mir-1911 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-1911-5p

Accession MIMAT0007885
Description Homo sapiens hsa-miR-1911-5p mature miRNA
Sequence 12 - UGAGUACCGCCAUGUCUGUUGGG - 34
Evidence experimental
454 [1]

Mature hsa-miR-1911-3p

Accession MIMAT0007886
Description Homo sapiens hsa-miR-1911-3p mature miRNA
Sequence 49 - CACCAGGCAUUGUGGUCUCC - 68
Evidence experimental
454 [1]

References

  1. PubMed ID: 18583537
    MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries
    "Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M"
    "Stem Cells (2008) 26:2496-2505