miRBase entry: hsa-mir-1913

Stem-loop hsa-mir-1913


Accession
MI0008334
Symbol
HGNC: MIR1913
Description
Homo sapiens hsa-mir-1913 precursor miRNA

Literature search
3 open access papers mention hsa-mir-1913
(3 sentences)

Sequence

62 reads, 1 reads per million, 30 experiments
accucuaccucccggcagaggaggcugcagaggcuggcuuuccaaaacUCUGCCCCCUCCGCUGCUGCCAaguggcuggu
(((.((((....((((((.(((((..((((((..(((....)))...))))))..))))).))))))....))))..)))

Structure
   -u    cucc      a     cu      -gc   c 
acc  cuac    cggcag ggagg  gcagag   ugg u
|||  ||||    |||||| |||||  ||||||   |||  
ugg  ggug    GUCGUC CCUCC  CGUCUc   acc u
   uc    aACC      G     CC      aaa   u 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr6: 166509354-166509433 [-]

Disease association
hsa-mir-1913 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-1913

Accession MIMAT0007888
Description Homo sapiens hsa-miR-1913 mature miRNA
Sequence 49 - UCUGCCCCCUCCGCUGCUGCCA - 70
Evidence experimental
454 [1]

References

  1. PubMed ID: 18583537
    MicroRNA discovery and profiling in human embryonic stem cells by deep sequencing of small RNA libraries
    "Bar M, Wyman SK, Fritz BR, Qi J, Garg KS, Parkin RK, Kroh EM, Bendoraite A, Mitchell PS, Nelson AM, Ruzzo WL, Ware C, Radich JP, Gentleman R, Ruohola-Baker H, Tewari M"
    "Stem Cells (2008) 26:2496-2505