miRBase entry: ptr-mir-451

Stem-loop ptr-mir-451


Accession
MI0008675
Description
Pan troglodytes ptr-mir-451 precursor miRNA


Sequence


uugggaauggcaaggAAACCGUUACCAUUACUGAGUUuaguaaugguaaugguucucuugcuauacccaga
(((((.(((((((((.(((((((((((((((((....))))))))))))))))).))))))))).))))).

Structure
-     a         A                 A 
 uuggg auggcaagg AACCGUUACCAUUACUG G
 ||||| ||||||||| |||||||||||||||||  
 gaccc uaucguucu uugguaaugguaaugau U
a     a         c                 U 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr17: 28309651-28309721 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from ptr-mir-451
Name Accession Chromosome Start End Strand Confidence




Database links

Mature ptr-miR-451

Accession MIMAT0008153
Description Pan troglodytes ptr-miR-451 mature miRNA
Sequence 16 - AAACCGUUACCAUUACUGAGUU - 37
Evidence not_experimental

References

  1. PubMed ID: 18760970
    Computational identification of novel microRNA homologs in the chimpanzee genome
    "Baev V, Daskalova E, Minkov I"
    "Comput Biol Chem (2009) 33:62-70