miRBase entry: ptr-mir-484

Stem-loop ptr-mir-484


Accession
MI0008680
Description
Pan troglodytes ptr-mir-484 precursor miRNA


Sequence


gccucgUCAGGCUCAGUCCCCUCCCGAUaaaccccuaaauagggacuuucccggggggugacccuggcuuuuuuggcg
(((..((((((....(((.(((((((..(((.((((....))))..)))..))))))).)))))))))......))).

Structure
-   ----uc      CUCA   C       AU   -c    a 
 gcc      gUCAGG    GUC CCUCCCG  aaa  cccu a
 |||      ||||||    ||| |||||||  |||  ||||  
 cgg      cggucc    cag ggggggc  uuu  ggga a
g   uuuuuu      ----   u       cc   ca    u 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr16: 15864338-15864415 [+]

Database links

Mature ptr-miR-484

Accession MIMAT0008158
Description Pan troglodytes ptr-miR-484 mature miRNA
Sequence 7 - UCAGGCUCAGUCCCCUCCCGAU - 28
Evidence not_experimental

References

  1. PubMed ID: 18760970
    Computational identification of novel microRNA homologs in the chimpanzee genome
    "Baev V, Daskalova E, Minkov I"
    "Comput Biol Chem (2009) 33:62-70