miRBase entry: ame-mir-1006

Stem-loop ame-mir-1006


Accession
MI0010617
Description
Apis mellifera ame-mir-1006 precursor miRNA

Literature search
1 open access papers mention ame-mir-1006
(1 sentences)

Sequence


auugguucugaaaagaauugaguaaauuuauauuaaauAAAAUUCGAUUUCUUCUAUCAUUA
..((((...(((..(((((((((...(((((.....)))))))))))))).))).))))...

Structure
-au    ucu   aa         aaa     a 
   uggu   gaa  gaauugagu   uuuau u
   ||||   |||  |||||||||   ||||| u
   ACUA   CUU  UUUAGCUUA   AAAua a
AUU    --U   -C         ---     a 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
CM000056.5: 1971255-1971316 [+]

Database links

Mature ame-miR-1006-3p

Accession MIMAT0010120
Description Apis mellifera ame-miR-1006-3p mature miRNA
Sequence 39 - AAAAUUCGAUUUCUUCUAUCAUUA - 62
Evidence experimental
Illumina [1-2]

References

  1. PubMed ID: 22409512
    Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome
    "Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y"
    "Genes Brain Behav (2012) 11:660-670

  2. PubMed ID: 26853694
    MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)
    "Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL"
    "Insect Mol Biol (2016) 25:216-226