Stem-loop bra-MIR171e

Accession

MI0010660

Description

Brassica rapa bra-MIR171e precursor miRNA

Literature search

7 open access papers mention bra-MIR171e
(13 sentences)

Sequence

acgaaagaguccucuuugauauuggccugguucacucagaucuuccagauuacacacguacuauauacauucucucaguuaucUGAUUGAGCCGCGCCAAUAUCucagugcucucucgu
((((.(((((...((..(((((((((.(((((((.((((((((...(((.....................)))...))..)))))).))))))).)))))))))..)).))))).))))

Structure

    a     ccu  uu         c       c      --  ucc   uuacacacg 
acga agagu   cu  gauauuggc ugguuca ucagau  cu   aga         u
|||| |||||   ||  ||||||||| ||||||| ||||||  ||   |||         a
ugcu ucucg   ga  CUAUAACCG GCCGAGU AGUcua  ga   ucu         c
    c     --u  cu         C       U      uu  cuc   uacauauau 

Annotation confidence Not enough data

Genome context

chrA3: 21911195-21911313 [+]

Mature bra-miR171e

• Accession: MIMAT0010165
• Description: Brassica rapa bra-miR171e mature miRNA
• Sequence: 84 - UGAUUGAGCCGCGCCAAUAUC - 104
• Evidence: experimental ; cloned [1], Northern [1]

References

1. PubMed ID: 18558089
   Characterization of conserved and novel microRNAs and their targets, including a TuMV-induced TIR-NBS-LRR class R gene-derived novel miRNA in Brassica
   "He XF, Fang YY, Feng L, Guo HS"
   "FEBS Lett (2008) 582:2445-2452


2. PubMed ID: 24559317
   Identification of novel and conserved miRNAs involved in pollen development in Brassica campestris ssp. chinensis by high-throughput sequencing and degradome analysis
   Jiang J, Lv M, Liang Y, Ma Z, Cao J
   BMC Genomics (2014) 15:146