miRBase entry: cel-mir-2215

Stem-loop cel-mir-2215


Accession
MI0010965
Description
Caenorhabditis elegans cel-mir-2215 precursor miRNA

Literature search
1 open access papers mention cel-mir-2215
(1 sentences)

Sequence

201 reads, 1 reads per million, 11 experiments
ACAGCACGUGUUACGAUGCUCCguuaguucggaguuuuuacggAGAAUCGUAGCGCGUGUUGUUU
(((((((((((((((((.((((((...............)))))).)))))))))))))))))..

Structure
--                 G      uaguuc 
  ACAGCACGUGUUACGAU CUCCgu      g
  ||||||||||||||||| ||||||      g
  UGUUGUGCGCGAUGCUA GAggca      a
UU                 A      uuuuug 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chrII: 13333763-13333827 [-]

Database links

Mature cel-miR-2215-5p

Accession MIMAT0011445
Description Caenorhabditis elegans cel-miR-2215-5p mature miRNA
Sequence 1 - ACAGCACGUGUUACGAUGCUCC - 22
Evidence experimental
Illumina [1]

Mature cel-miR-2215-3p

Accession MIMAT0011446
Description Caenorhabditis elegans cel-miR-2215-3p mature miRNA
Sequence 44 - AGAAUCGUAGCGCGUGUUGUUU - 65
Evidence experimental
Illumina [1]
Database links
Predicted targets

References

  1. PubMed ID: 19460142
    Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development
    Kato M, de Lencastre A, Pincus Z, Slack FJ
    Genome Biol (2009) 10:R54