miRBase entry: osa-MIR2118j

Stem-loop osa-MIR2118j


Accession
MI0011260
Description
Oryza sativa osa-MIR2118j precursor miRNA

Literature search
28 open access papers mention osa-MIR2118j
(163 sentences)

Sequence


ggugagccaggaagaggaagagagacucuaagagcaguaggaaugggaacaugaaggaaagccaaauuaagcucuaaccucugguauuggagauuuggucugaugauuUUCCUGAUGCCUCCCAUUCCUAuaguucuuaggugcucguuccucuuacuuucagcuaacacc
(((((((.(((((((((((..(((((.((((((((.((((((((((((.(((..(((((((((((((....((((((((...)))..))))))))))))........)))))).)))..)))))))))))).)))))))))).))).)))))))).)))...)))..))))

Structure
    --   --c   -        ga   -  u        a            -a   ga      --------       uaag     --   u 
ggug  agc   agg aagaggaa  gag ac cuaagagc guaggaauggga  cau  aggaaa        gccaaau    cucua  acc  
||||  |||   ||| ||||||||  ||| || |||||||| ||||||||||||  |||  ||||||        |||||||    |||||  ||| c
ccac  ucg   uuc uucuccuu  cuc ug gauucuug uAUCCUUACCCU  GUA  UCCUUu        ugguuua    gaggu  ugg  
    aa   acu   a        -g   g  -        a            CC   -G      uaguaguc       ----     ua   u 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
Chr4: 21654594-21654764 [-]
Clustered miRNAs
15 other miRNAs are < 10 kb from osa-MIR2118j
Name Accession Chromosome Start End Strand Confidence




Database links

Mature osa-miR2118j

Accession MIMAT0011749
Description Oryza sativa osa-miR2118j mature miRNA
Sequence 109 - UUCCUGAUGCCUCCCAUUCCUA - 130
Evidence experimental
454 [1]

References

  1. PubMed ID: 19584097
    Clusters and superclusters of phased small RNAs in the developing inflorescence of rice
    "Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH"
    "Genome Res (2009) 19:1429-1440