miRBase entry: hsa-mir-2278

Stem-loop hsa-mir-2278


Accession
MI0011285
Symbol
HGNC: MIR2278
Description
Homo sapiens hsa-mir-2278 precursor miRNA mir-2278
Gene
family?
RF04166; mir-2278

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR2278 is a microRNA whose upregulation has been linked to the suppression of leukemic cell growth and the promotion of apoptosis [PMC7277136]. This microRNA has not been previously associated with pancreatic cancer, marking a novel area of investigation [PMC7277136]. Bioinformatic analyses suggest that compounds such as sulforaphane, SF102, and SF134 may modulate NF-κB signaling pathways through the induction of MIR2278, which in turn could regulate a variety of NF-κB target genes [PMC7277136]. Among the miRNAs analyzed, MIR2278 stands out as it is predicted to influence the largest number of NF-κB-related genes [PMC7277136]. Furthermore, MIR2278 has been identified as significantly downregulated in response to treatments with sulforaphane and related compounds [PMC7277136]. This downregulation contrasts with findings in other studies where MIR2278 is among the most upregulated miRNAs under certain conditions [PMC4215582], suggesting context-dependent roles for this microRNA in cellular processes related to cancer.

Literature search
2 open access papers mention hsa-mir-2278
(2 sentences)

Sequence

466 reads, 6 reads per million, 52 experiments
gugcugcagguguugGAGAGCAGUGUGUGUUGCCUGGggacuguguggacugguaucacccagacagcuugcacugacuccagacccugccgucau
((((.(((((.(((((((..((((((..((((.(((((((((((....)).))..)).))))).))))..)))))).))))).))))))).).)))

Structure
   - u     u  -     AG      GU    C     -  --  -  g 
gug c gcagg gu ugGAG  CAGUGU  GUUG CUGGg ga  cu gu u
||| | ||||| || |||||  ||||||  |||| ||||| ||  || ||  
uac g cgucc ca accuc  gucacg  cgac gaccc cu  gg ca g
   u c     -  g     -a      uu    a     a  au  u  g 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr9: 94809962-94810057 [+]

Disease association
hsa-mir-2278 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-2278

Accession MIMAT0011778
Description Homo sapiens hsa-miR-2278 mature miRNA
Sequence 16 - GAGAGCAGUGUGUGUUGCCUGG - 37
Evidence experimental
454 [1]
Database links
Predicted targets

References

  1. PubMed ID: 19508715
    Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing
    Nygaard S, Jacobsen A, Lindow M, Eriksen J, Balslev E, Flyger H, Tolstrup N, Møller S, Krogh A, Litman T
    BMC Med Genomics (2009) 2:35