The only available information about MIR2278 and cancer is that its upregulation is associated with the inhibition of leukemic cell proliferation and enhanced apoptosis [PMC7277136]. Interestingly, our miRNA candidates MIR2278, miR27b-5p and miR29b-1-5p have never before been documented in pancreatic cancer, as far as we know [PMC7277136]. Our bioinformatic analysis of miRNA array data now predict that sulforaphane, SF102, and SF134 affect NF-κB signaling by the induction of MIR2278, which is involved in the regulation of many NF-κB target genes [PMC7277136]. The top candidate was MIR2278, because it was predicted to regulate the highest number of NF-κB-related target genes, followed by miR27b-5p and miR29b-1-5p, which partially overlapped in regulation of NF-κB-related target genes [PMC7277136]. By this method, we identified MIR2278 as common and most significantly downregulated miRNA following sulforaphane, SF102, and SF134 treatment (Table S1) [PMC7277136]. In a separate study, it was observed that MIR2278 was one of the most upregulated microRNAs [PMC4215582].
- u u - AG GU C - -- - g gug c gcagg gu ugGAG CAGUGU GUUG CUGGg ga cu gu u ||| | ||||| || ||||| |||||| |||| ||||| || || || uac g cgucc ca accuc gucacg cgac gaccc cu gg ca g u c - g -a uu a a au u g
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0011778 |
Description | Homo sapiens hsa-miR-2278 mature miRNA |
Sequence | 16 - GAGAGCAGUGUGUGUUGCCUGG - 37 |
Evidence |
experimental
454 [1] |
Database links | |
Predicted targets |
|