miRBase entry: hsa-mir-2278

Stem-loop hsa-mir-2278


Accession
MI0011285
Symbol
HGNC: MIR2278
Description
Homo sapiens hsa-mir-2278 precursor miRNA mir-2278
Gene
family?
RF04166; mir-2278

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

The only available information about MIR2278 and cancer is that its upregulation is associated with the inhibition of leukemic cell proliferation and enhanced apoptosis [PMC7277136]. Interestingly, our miRNA candidates MIR2278, miR27b-5p and miR29b-1-5p have never before been documented in pancreatic cancer, as far as we know [PMC7277136]. Our bioinformatic analysis of miRNA array data now predict that sulforaphane, SF102, and SF134 affect NF-κB signaling by the induction of MIR2278, which is involved in the regulation of many NF-κB target genes [PMC7277136]. The top candidate was MIR2278, because it was predicted to regulate the highest number of NF-κB-related target genes, followed by miR27b-5p and miR29b-1-5p, which partially overlapped in regulation of NF-κB-related target genes [PMC7277136]. By this method, we identified MIR2278 as common and most significantly downregulated miRNA following sulforaphane, SF102, and SF134 treatment (Table S1) [PMC7277136]. In a separate study, it was observed that MIR2278 was one of the most upregulated microRNAs [PMC4215582].

Literature search
2 open access papers mention hsa-mir-2278
(2 sentences)

Sequence

466 reads, 25 reads per million, 52 experiments
gugcugcagguguugGAGAGCAGUGUGUGUUGCCUGGggacuguguggacugguaucacccagacagcuugcacugacuccagacccugccgucau
((((.(((((.(((((((..((((((..((((.(((((((((((....)).))..)).))))).))))..)))))).))))).))))))).).)))

Structure
   - u     u  -     AG      GU    C     -  --  -  g 
gug c gcagg gu ugGAG  CAGUGU  GUUG CUGGg ga  cu gu u
||| | ||||| || |||||  ||||||  |||| ||||| ||  || ||  
uac g cgucc ca accuc  gucacg  cgac gaccc cu  gg ca g
   u c     -  g     -a      uu    a     a  au  u  g 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr9: 94809962-94810057 [+]

Disease association
hsa-mir-2278 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-2278

Accession MIMAT0011778
Description Homo sapiens hsa-miR-2278 mature miRNA
Sequence 16 - GAGAGCAGUGUGUGUUGCCUGG - 37
Evidence experimental
454 [1]
Database links
Predicted targets

References

  1. PubMed ID: 19508715
    Identification and analysis of miRNAs in human breast cancer and teratoma samples using deep sequencing
    Nygaard S, Jacobsen A, Lindow M, Eriksen J, Balslev E, Flyger H, Tolstrup N, Møller S, Krogh A, Litman T
    BMC Med Genomics (2009) 2:35