WARNING: This summary was generated by AI. MIR2278 is a microRNA whose upregulation has been linked to the suppression of leukemic cell growth and the promotion of apoptosis [PMC7277136]. This microRNA has not been previously associated with pancreatic cancer, marking a novel area of investigation [PMC7277136]. Bioinformatic analyses suggest that compounds such as sulforaphane, SF102, and SF134 may modulate NF-κB signaling pathways through the induction of MIR2278, which in turn could regulate a variety of NF-κB target genes [PMC7277136]. Among the miRNAs analyzed, MIR2278 stands out as it is predicted to influence the largest number of NF-κB-related genes [PMC7277136]. Furthermore, MIR2278 has been identified as significantly downregulated in response to treatments with sulforaphane and related compounds [PMC7277136]. This downregulation contrasts with findings in other studies where MIR2278 is among the most upregulated miRNAs under certain conditions [PMC4215582], suggesting context-dependent roles for this microRNA in cellular processes related to cancer.
- u u - AG GU C - -- - g gug c gcagg gu ugGAG CAGUGU GUUG CUGGG ga cu gu u ||| | ||||| || ||||| |||||| |||| ||||| || || || uac g cgucc ca ACCUC GUCACG CGAC GACcc cu gg ca g u c - g -A UU A a au u g
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0011778 |
| Description | Homo sapiens hsa-miR-2278-5p mature miRNA |
| Sequence | 16 - GAGAGCAGUGUGUGUUGCCUGGG - 38 |
| Evidence |
experimental
454 [1] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0050550 |
| Description | Homo sapiens hsa-miR-2278-3p mature miRNA |
| Sequence | 61 - CAGACAGCUUGCACUGACUCCA - 82 |
| Evidence |
experimental
454 [1] |
|