miRBase entry: bmo-mir-2757

Stem-loop bmo-mir-2757


Accession
MI0012311
Description
Bombyx mori bmo-mir-2757 precursor miRNA


Sequence

516 reads, 90 reads per million, 3 experiments
aauuauugaaACGGGAAUGGUCACUUACAACUguuuuuucuuucuagCUGAAAGUGUCCAUUUCCGUUuugauacuau
...(((((((((((((((((.(((((.((.(((...........))).)).))))).)))))))))))))))))....

Structure
-aau                 U     A  A   uuuu 
    uauugaaACGGGAAUGG CACUU CA CUg    u
    ||||||||||||||||| ||||| || |||    u
    auaguuUUGCCUUUACC GUGAA GU gau    c
uauc                 U     A  C   cuuu 


Annotation confidence Medium
Do you think this miRNA is real?

Genome context
NW_004582009.1: 1928109-1928186 [-]

Database links

Mature bmo-miR-2757-5p

Accession MIMAT0013627
Description Bombyx mori bmo-miR-2757-5p mature miRNA
Sequence 11 - ACGGGAAUGGUCACUUACAACU - 32
Evidence experimental
Illumina [1], SOLID [2]
Database links

Mature bmo-miR-2757-3p

Accession MIMAT0013628
Description Bombyx mori bmo-miR-2757-3p mature miRNA
Sequence 48 - CUGAAAGUGUCCAUUUCCGUU - 68
Evidence experimental
Illumina [1], SOLID [2]
Database links

References

  1. PubMed ID: 20199675
    MicroRNAs of Bombyx mori identified by Solexa sequencing
    Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q
    BMC Genomics (2010) 11:148

  2. PubMed ID: 20229201
    Novel microRNAs in silkworm (Bombyx mori)
    "Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J"
    "Funct Integr Genomics (2010) 10:405-415