miRBase entry: osa-MIR2924

Stem-loop osa-MIR2924


Accession
MI0013266
Description
Oryza sativa osa-MIR2924 precursor miRNA


Sequence


ugucaucguccucugcagccuuaccccucguuugugccguggucgccgccugcuagagaugcguguggagcucagccuugcccCUCGCUUGCUCCGGCCGCCACcgcuccgccggccugc
..............((((((.............(((..(((((.((.((((((.......)))...(((((..(((..........))).)))))))).)).)))))..))).)).))))

Structure
ugucaucguccucu    -  uuaccccucguuu   cc     c  c   ugcuagagaugcgugu     uc   cuug 
              gcag cc             gug  guggu gc gcc                ggagc  agc    c
              |||| ||             |||  ||||| || |||                |||||  |||     
              cguc gg             cgc  cgcCA CG CGG                CCUCG  UCG    c
--------------    c  ------------c   cu     C  C   ----------------     -U   CUCc 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
Chr1: 11894321-11894440 [+]

Database links

Mature osa-miR2924

Accession MIMAT0014055
Description Oryza sativa osa-miR2924 mature miRNA
Sequence 84 - CUCGCUUGCUCCGGCCGCCAC - 104
Evidence experimental
cloned [1]

References

  1. PubMed ID: 20131478
    Cloning and validation of novel miRNA from basmati rice indicates cross talk between abiotic and biotic stresses
    "Sanan-Mishra N, Kumar V, Sopory SK, Mukherjee SK"
    "Mol Genet Genomics (2009) 282:463-474