miRBase entry: rco-MIR395a

Stem-loop rco-MIR395a


Accession
MI0013413
Description
Ricinus communis rco-MIR395a precursor miRNA

Literature search
2 open access papers mention rco-MIR395a
(7 sentences)

Sequence


cuagaguucccuugaacacuucacugggacgaaaauccauucuuccaaCUGAAGUGUUUGGGGGAACUCuuggu
(.(((((((((((((((((((((.(((((.(((......))))))))..))))))))))))))))))))).)..

Structure
-- u                     -c     c   aa 
  c agaguucccuugaacacuuca  uggga gaa  u
  | |||||||||||||||||||||  ||||| |||   
  g uCUCAAGGGGGUUUGUGAAGU  accuu cuu  c
ug u                     Ca     -   ac 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
EQ973849.1: 133932-134005 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from rco-MIR395a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rco-miR395a

Accession MIMAT0014187
Description Ricinus communis rco-miR395a mature miRNA
Sequence 49 - CUGAAGUGUUUGGGGGAACUC - 69
Evidence experimental
RT-PCR [1]

References

  1. PubMed ID: 19942686
    Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants
    "Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M"
    "Nucleic Acids Res (2010) 38:981-995