miRBase entry: tgu-mir-29a-2

Stem-loop tgu-mir-29a-2


Accession
MI0013746
Description
Taeniopygia guttata tgu-mir-29a-2 precursor miRNA

Literature search
1 open access papers mention tgu-mir-29a-2
(3 sentences)

Sequence


UGACCGAUUUCUCUUGGUGUUCagagucucaguuuuugucUAGCACCAUUUGAAAUCGGUUaugauguagg
(((((((((((...(((((((.(((.............))))))))))...))))))))))).........

Structure
---------           UCU       C   gucuc 
         UGACCGAUUUC   UGGUGUU aga     a
         |||||||||||   ||||||| |||     g
         aUUGGCUAAAG   ACCACGA Ucu     u
ggauguagu           UUU       -   guuuu 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr26: 3761359-3761429 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from tgu-mir-29a-2
Name Accession Chromosome Start End Strand Confidence




Database links

Mature tgu-miR-29a-3p

Accession MIMAT0014532
Description Taeniopygia guttata tgu-miR-29a-3p mature miRNA
Sequence 41 - UAGCACCAUUUGAAAUCGGUU - 61
Evidence experimental
454 [1], Illumina [1-2]

Mature tgu-miR-29a-2-5p

Accession MIMAT0031063
Description Taeniopygia guttata tgu-miR-29a-2-5p mature miRNA
Sequence 1 - UGACCGAUUUCUCUUGGUGUUC - 22
Evidence experimental
Illumina [2]

References

  1. PubMed ID: 20360741
    The genome of a songbird
    "Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li"
    "Nature (2010) 464:757-762

  2. PubMed ID: 23268654
    Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression
    Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X
    BMC Genomics (2012) 13:727