MIR3158-2 is a gene located on chromosome 10q24.31-10q24.32 that is involved in the development of Split Hand/Foot Malformation (SHFM) [PMC5003447]. In SHFM cases without microarray data, the shortest duplication region includes MIR3158-2, along with other genes such as BTRC, POLL, DPCD, and a portion of FBXW4 [PMC5003447]. In cases with SHFM phenotype and microarray data, the duplication region typically contains MIR3158-2 along with LBX1, FLJ41350, AX747408, BTRC, POLL, DPCD, MIR3158-1 and FBXW4 or a portion of FBXW4 [PMC5003447]. In some SHFM cases with two discontinuous duplications at 10q24.31–q24.32 (Patient 12–15), one segment contains MIR3158-2 along with POLL and DPCD while the other segment contains LBX1 and a portion of BTRC [PMC5003447'>PMC5003447]. Additionally, in Patient 18 who does not have classical SHFM phenotype but exhibits other symptoms such as short palm and small feet, hypertelorism (wide-set eyes), intellectual disability and obesity; a duplication region at 10q24.31-q24.32 includes MIR3158-2 along with POLL and DPCD [PMC5003447]. These findings suggest that duplications involving MIR3158-2 are associated with SHFM phenotype as well as other developmental abnormalities [PMC5003447].
caauac auucaggccgguCCUGCAGAGAGGAAGCCCUUC c ||||||||||||||||||||||||||||||||| u uaaguccggcCAGGACGUCUCUCCUUCGGGAAg g acgaau
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0015032 |
Description | Homo sapiens hsa-miR-3158-3p mature miRNA |
Sequence | 50 - AAGGGCUUCCUCUCUGCAGGAC - 71 |
Evidence |
experimental
Illumina [1-2] |
Database links | |
Predicted targets |
Accession | MIMAT0019211 |
Description | Homo sapiens hsa-miR-3158-5p mature miRNA |
Sequence | 13 - CCUGCAGAGAGGAAGCCCUUC - 33 |
Evidence | not_experimental |
|