Stem-loop hsa-mir-3065

Accession

MI0014228

Symbol

HGNC: MIR3065

Description

Homo sapiens hsa-mir-3065 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR3065 is an important nonprotein coding regulatory gene that may play a key role in breast cancer (BC) development and heterogeneity among African American (AA) women [PMC5989404]. It is located in the seventh intron of the apoptosis-associated tyrosine kinase (AATK) gene and transcribed in the opposite direction from its host gene [PMC5989404]. MIR3065 has been found to be encoded in a region with high-level genomic amplification in various subtypes of BC [PMC5989404]. It has been shown to have a disparate expression pattern between normal breast tissue and breast tumors [PMC5989404'>PMC5989404'>PMC5989404'>PMC5989404'>PMC5989404]. The genomic region that includes MIR3065 also contains the brain-specific angiogenesis inhibitor 1-associated protein 2 (BAIAP2) gene [PMC5989404]. The role of MIR3065 may be to suppress expression of oncogenes, as it has been found to have predicted targets that are likely oncogenes [PMC5989404]. Functional assessment is needed to understand the molecular mechanism behind the association between BC risk, particularly ER positive BC, and SNPs in BAIAP2 and MIR3065 [PMC5989404]. MIR3065 shares its genomic location with mature MIR338, but they are transcribed from opposite DNA strands [PMC5989404]. Additionally, a SNP within the precursor sequence of MIR4739 has been found near one of the top hits in MIR3065 but is not highly linked with it [PMC5989404]. Among TargetScan's predicted gene targets for MIR3065 are AT-rich interaction domain 4B (ARID4B) and RAB22A, which are involved in signal transduction and belong to oncogene families [PMC5989404][PMID:10138222[PMID:10138222].

Literature search

8 open access papers mention hsa-mir-3065
(50 sentences)

Sequence

65923 reads, 224 reads per million, 148 experiments

cugcccucuUCAACAAAAUCACUGAUGCUGGAgucgccugagucaucacUCAGCACCAGGAUAUUGUUGGAGaggacag
(((.((((((((((((.(((.(((.(((((((.((....)).))......))))).)))))).)))))))))))).)))

Structure

   c            A   A   A     ------  g  g 
cug ccucuUCAACAA AUC CUG UGCUG      GA uc c
||| |||||||||||| ||| ||| |||||      || ||  
gac ggaGAGGUUGUU UAG GAC ACGAC      cu ag c
   a            A   -   C     Ucacua  g  u 

Annotation confidence High

Genome context

chr17: 81125877-81125955 [+]

Clustered miRNAs

3 other miRNAs are < 10 kb from hsa-mir-3065

Disease association

hsa-mir-3065 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-3065-5p

• Accession: MIMAT0015066
• Description: Homo sapiens hsa-miR-3065-5p mature miRNA
• Sequence: 10 - UCAACAAAAUCACUGAUGCUGGA - 32
• Evidence: experimental ; Illumina [1,3], 454 [2]

Mature hsa-miR-3065-3p

• Accession: MIMAT0015378
• Description: Homo sapiens hsa-miR-3065-3p mature miRNA
• Sequence: 50 - UCAGCACCAGGAUAUUGUUGGAG - 72
• Evidence: experimental ; Illumina [1,3], 454 [2]

References

1. PubMed ID: 20300190
   Characterization of the Melanoma miRNAome by Deep Sequencing
   "Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK"
   "PLoS One (2010) 5:e9685


2. PubMed ID: 20483914
   Discovery of microRNAs and other small RNAs in solid tumors
   "Meiri E, Levy A, Benjamin H, Ben-David M, Cohen L, Dov A, Dromi N, Elyakim E, Yerushalmi N, Zion O, Lithwick-Yanai G, Sitbon E"
   "Nucleic Acids Res (2010) 38:6234-6246


3. PubMed ID: 21199797
   Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene
   "Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C"
   "Cancer Res (2011) 71:78-86