miRBase entry: hsa-mir-378c

Stem-loop hsa-mir-378c


Accession
MI0015825
Symbol
HGNC: MIR378C
Description
Homo sapiens hsa-mir-378c precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR378C is a member of the miR-378 family and is frequently downregulated in colorectal cancer (CRC) [PMC9263271]. Several studies have evaluated miRNAs, including MIR378C, as potential diagnostic and prognostic biomarkers for sepsis [PMC8358855]. Serum MIR126 has been proposed as a potential candidate biomarker for sepsis, with reduced levels compared to non-infectious conditions [PMC8358855]. The reduced levels of MIR126 and MIRLET7I in plasma of sepsis patients corroborate previous observations in serum samples [PMC8358855]. Host leukocyte miRNAs have also been found to have altered expression in sepsis patients with different causative pathogens, including MIR100, MIR501, MIR99A, MIR483, MIR141, MIR378C, and MIR193B [PMC8358855]. In a study on satellite cells in mice, upregulation of genes promoting cell death (e.g., H19 and Fndc1) and downregulation of genes promoting cell survival (e.g., Dhcr24 and Snord65) were observed in the absence of scERαKO satellite cells compared to scERαWT satellite cells. The upregulated gene H19 is associated with the downregulation of the gene mir378c [PMC6655560]. In gastric cancer patients, low expression levels of MIR378C were observed. This suggests that it has potential as a diagnostic and prognostic indicator for gastric cancer [PMC8017737]. Differentiation status, TNM staging (tumor-node-metastasis staging), and low expression levels of MIR378C were found to be effective independent factors for prognosis in gastric cancer patients [PMC8017737].

Literature search
193 open access papers mention hsa-mir-378c
(913 sentences)

Sequence

1122138 reads, 4181 reads per million, 126 experiments
ggaggccaucACUGGACUUGGAGUCAGAAGAGUGGagucgggucagacuucaacucugacuuugaagguggugagugccuc
.(((((..((((((...(((((((((((....(((((((......)))))))..)))))))))))...))))))..)))))

Structure
g     ca      GAC           AGAG       gg 
 gaggc  ucACUG   UUGGAGUCAGA    UGGaguc  g
 |||||  ||||||   |||||||||||    |||||||   
 cuccg  aguggu   aguuucagucu    acuucag  u
-     ug      gga           --ca       ac 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr10: 130962588-130962668 [-]

Disease association
hsa-mir-378c is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-378c

Accession MIMAT0016847
Description Homo sapiens hsa-miR-378c mature miRNA
Sequence 11 - ACUGGACUUGGAGUCAGAAGAGUGG - 35
Evidence experimental
SOLiD [1]
Database links
Predicted targets

References

  1. PubMed ID: 19784364
    Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors
    Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP
    PLoS One (2009) 4:e7192