MIR4324 is a microRNA whose expression in thyroid carcinoma patients had not been previously described before a recent study [PMC9221779]. This study found that MIR4324, along with other miRNAs, could enhance the diagnostic accuracy of fine-needle thyroid node biopsies, distinguishing malignant from benign thyroid nodules [PMC9221779]. Notably, a higher expression of MIR4324 is linked to papillary carcinoma that extends beyond the thyroid gland [PMC9221779]. The study revealed that an increase in MIR4324 expression significantly raises the likelihood of the disease being cancerous with metastasis [PMC9221779'>PMC9221779]. The diagnostic accuracy of MIR4324 was confirmed through ROC curve analysis, which showed it was effective in identifying patients with papillary thyroid carcinoma (PTC) [PMC9221779]. Furthermore, RT-PCR analysis confirmed higher relative expression levels of MIR4324 in PTC compared to benign nodules [PMC9221779]. Contrary to the original summary, the study actually found that patients with PTC with lymph node metastasis (LNM) had significantly higher levels of MIR4324 compared to those with PTC without LNM [PMC9221779], suggesting its potential role in assessing the risk and prognosis of thyroid carcinoma.
-- c --- a cucca gaac cggc ccuuu guua gggucucag gg u |||| ||||| |||| ||||||||| || u gucg ggaAA CAAU CCCAGAGUC CC u ac u UUC - ----- aaaa
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0016876 |
Description | Homo sapiens hsa-miR-4324 mature miRNA |
Sequence | 43 - CCCUGAGACCCUAACCUUAA - 62 |
Evidence |
experimental
SOLiD [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|