Accession
MI0015854
Symbol
HGNC:
MIR4324
Description
Homo sapiens
hsa-mir-4324 precursor miRNA
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
MIR4324 is a microRNA that has not been previously described in the literature in relation to thyroid carcinoma patients [PMC9221779]. However, a study showed that the expression analysis of four miRNAs, including MIR4324, could improve the accuracy of fine-needle thyroid node biopsy and differentiate between malignant and benign thyroid nodules [PMC9221779]. Higher expression of MIR4324 is associated with papillary carcinoma extending beyond the thyroid gland, while higher expression of miR221 is associated with multifocality, which could help assess the risk and prognosis of thyroid carcinoma [PMC9221779]. The study found that a one-fold increase in MIR4324 value increases the odds of having cancerous disease with metastasis by 8.3 times compared to benign disease [PMC9221779'>PMC9221779'>PMC9221779'>PMC9221779'>PMC9221779]. The expression levels of four miRNAs, including MIR4324, differed significantly between malignant and benign cases [PMC9221779]. ROC curve analysis showed that MIR4324 was able to identify patients with papillary thyroid carcinoma (PTC) very well [PMC9221779]. The study also found significantly higher expression of MIR4324 in patients with PTC without lymph node metastasis compared to those with lymph node metastasis [PMC9221779]. However, RT-PCR analysis did not confirm the difference in expression between groups obtained by next-generation sequencing for miR125A, miR200B, and MIR4324 [PMC9221779]. Overall, higher expression levels of miR125A and MIR4324 were observed in patients with extrathyroidal tumor extension compared to those without extension [PMC9221779].
Sequence
31
reads,
22
reads per million, 9 experiments
cggccccuuuguuaagggucucagcuccagggaacuuuaaaaCCCUGAGACCCUAACCUUAAaggugcugca
((((.(((((((((.(((((((((.....((...........)))))))))))))))...))))).))))..
((((.(((((((((.(((((((((.....((...........)))))))))))))))...))))).))))..
Structure
-- c --- a cucca gaac cggc ccuuu guua gggucucag gg u |||| ||||| |||| ||||||||| || u gucg ggaAA CAAU CCCAGAGUC CC u ac u UUC - ----- aaaa
Annotation confidence
Not enough data
Do you think this miRNA is real?
Genome context
chr19: 49308797-49308868 [-]
Disease association
hsa-mir-4324 is associated with one or more human diseases in the Human microRNA Disease Database
| Disease | Description | Category | PubMed ID |
|---|
Database links
Mature hsa-miR-4324
| Accession | MIMAT0016876 |
| Description | Homo sapiens hsa-miR-4324 mature miRNA |
| Sequence | 43 - CCCUGAGACCCUAACCUUAA - 62 |
| Evidence |
experimental
SOLiD [1] |
| Database links |
|
| Predicted targets |
|
References
|
