WARNING: This summary was generated by AI. MIR3609, a microRNA, has been identified as a potential biomarker for locally advanced breast cancer due to its downregulated expression [PMC9818474]. It contributes to the immune response against breast cancer by inhibiting the PD-L1 immune checkpoint, potentially enhancing the effectiveness of immune-mediated tumor cell clearance [PMC7527443]. MIR3609 can also bind to the 3′ UTR region of PD-L1 mRNA and reduce its expression, which may sensitize breast cancer cells to the chemotherapeutic agent doxorubicin [PMC9713762]. While the downregulation of MIR3609 and its precursor in cells with inhibited kalirin–GEF1 has been observed, it implies a regulatory mechanism that may lead to the upregulation of their target genes, which are involved in processes such as cell morphogenesis and neuron differentiation [PMC8017594, PMC9727336].'>PMC9727336].. Moreover, the upregulation of MIR3609 has been associated with increased sensitivity of breast cancer cells to Adriamycin, which is synonymous with doxorubicin [PMC9727336].
-- aa aacuu - ccu c gu cagu uuauuc ucauuuu uuucucuac || |||| |||||| ||||||| ||||||||| u cg GUCG AAUGAG AGUGAAA gaagagaug cc ag GUCAU U --C u
| Accession | MIMAT0017986 |
| Description | Homo sapiens hsa-miR-3609 mature miRNA |
| Sequence | 51 - CAAAGUGAUGAGUAAUACUGGCUG - 74 |
| Evidence |
experimental
Illumina [1] |
| Database links |
|
| Predicted targets |
|
|