WARNING: This summary was generated by AI. MIR3613 is a microRNA encoded by the MIR3613 gene, which is located on chromosome 13 near the tumor suppressor genes RB1 and BRCA2 [PMC7836180]. The deletion of MIR3613 has been observed in breast cancer (BC) genomes and is correlated with specific molecular subtypes, particularly showing an unfavorable prognosis in estrogen receptor-positive (ER+) BC patients [PMC8131824]. The deletion of MIR3613 has been associated with higher expression levels of stemness genes such as SOX2, NANOG, and LIN28B as well as cell cycle-related genes including CDC6, CDC25A, CDK1, ATM, E2F1, and MKI67 in BC patients [PMC7836180]. This genomic loss is more common in breast cancer subtypes with a poorer prognosis and less frequent in the luminal A subtype which has a comparatively favorable prognosis [PMC7836180]. Additionally, breast cancer samples with MIR3613 deletion exhibit decreased NEAT1 expression and increased SNHG16 expression [PMC7836180]. The study of TCGA breast cancer samples revealed that nearly 46% had deletions at the MIR3613 locus [PMC7836180]'>PMC7836180], indicating that such deletions are a common occurrence in BC. Despite these findings indicating an association between MIR3613 deletion and poor prognosis in ER+ BC patients specifically [PMC7836180], no significant correlation between MIR3613 copy number and survival was observed across the entire cohort or ER-negative subset of BC patients [PMC7836180].
uug u uU UA g ugc ugg ggu ugga GUUG CUUUUUUUUUUGUUC u a ||| ||| |||| |||| ||||||||||||||| | u acu cca aCUU CAAC GAAAAAAAAAACAag a u uca c CC CC g uuu
| Accession | MIMAT0017990 |
| Description | Homo sapiens hsa-miR-3613-5p mature miRNA |
| Sequence | 16 - UGUUGUACUUUUUUUUUUGUUC - 37 |
| Evidence |
experimental
Illumina [1] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0017991 |
| Description | Homo sapiens hsa-miR-3613-3p mature miRNA |
| Sequence | 53 - ACAAAAAAAAAAGCCCAACCCUUC - 76 |
| Evidence |
experimental
Illumina [1] |
| Database links |
|
| Predicted targets |
|
|