miRBase entry: hsa-mir-3614

Stem-loop hsa-mir-3614


Accession
MI0016004
Symbol
HGNC: MIR3614
Description
Homo sapiens hsa-mir-3614 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR3614 is a microRNA (miRNA) hub in the greenyellow module, and it is suggested to play an important role in inflammation and immune response in human intracerebral hemorrhage (ICH) [PMC6399982]. The MIR3614 hub is connected to 40 genes, which are enriched in IL-6 and IL-10 signaling, granulocyte adhesion and diapedesis, and phagosome formation [PMC6399982]. Little is known about MIR3614, but it is found to be inter-connected with genes involved in various biological processes [PMC6399982]. In a study on a microdeletion associated with NOG-SSD (nail-patella syndrome with isolated nephropathy), the 1.6-Mb microdeletion includes MIR3614 among thirteen other genes [PMC4376726]. The deletion of MIR3614 may contribute to the pathogenesis of NOG-SSD along with other genes involved in various cellular processes [PMC4376726]. Overall, MIR3614 appears to be an important miRNA involved in inflammation and immune response, but further research is needed to fully understand its role and mechanisms of action.

Literature search
9 open access papers mention hsa-mir-3614
(75 sentences)

Sequence

569 reads, 107 reads per million, 52 experiments
gguucugucuugggCCACUUGGAUCUGAAGGCUGCCCcuuugcucucuggggUAGCCUUCAGAUCUUGGUGUUUUgaauucuuacu
.........(((((.((((.((((((((((((((((((..........)))))))))))))))))).)))).))))).........

Structure
gguucuguc     C    U                  uuug 
         uuggg CACU GGAUCUGAAGGCUGCCCc    c
         ||||| |||| ||||||||||||||||||     
         agUUU GUGG UCUAGACUUCCGAUgggg    u
ucauucuua     U    U                  ucuc 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr17: 56891270-56891355 [-]

Database links

Mature hsa-miR-3614-5p

Accession MIMAT0017992
Description Homo sapiens hsa-miR-3614-5p mature miRNA
Sequence 15 - CCACUUGGAUCUGAAGGCUGCCC - 37
Evidence experimental
Illumina [1-3]
Database links
Predicted targets

Mature hsa-miR-3614-3p

Accession MIMAT0017993
Description Homo sapiens hsa-miR-3614-3p mature miRNA
Sequence 53 - UAGCCUUCAGAUCUUGGUGUUUU - 75
Evidence experimental
Illumina [1-3]
Database links
Predicted targets

References

  1. PubMed ID: 20459774
    Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls
    Witten D, Tibshirani R, Gu SG, Fire A, Lui WO
    BMC Biol (2010) 8:58

  2. PubMed ID: 21199797
    Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene
    "Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C"
    "Cancer Res (2011) 71:78-86

  3. PubMed ID: 21807764
    Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome
    "Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM"
    "Hum Mol Genet (2011) 20:4025-4040