miRBase entry: ame-mir-1175

Stem-loop ame-mir-1175


Accession
MI0016137
Description
Apis mellifera ame-mir-1175 precursor miRNA

Literature search
1 open access papers mention ame-mir-1175
(1 sentences)

Sequence


caaaaauaaauaauaugcaagaaagggauuaugguucaaguggagaaguggucuuuacgcuuugaauuaaagUGAGAUUCACUCCUCCAACUUACuccugaucccuaauauucuucguuuuuuuuuuuuauuuguuuc
...((((((((((...(((((((((((((((.((...((((((((.((((((((...(((((((...)))))))))).))))).)))).))))...))))))))))....))))).)).........)))))))))).

Structure
caa          ------uau  -     ----        u  uuc    -    a     -   uua       a 
   aaauaaauaa         gc aagaa    agggauua gg   aagu ggag agugg ucu   cgcuuug  
   ||||||||||         || |||||    |||||||| ||   |||| |||| ||||| |||   ||||||| a
   uuuguuuauu         ug uucuu    ucccuagu cc   UUCA CCUC UCACU AGA   GUgaaau  
--c          uuuuuuuuu  c     auaa        -  uCA    A    C     U   ---       u 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
GL631151.1: 2090-2227 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from ame-mir-1175
Name Accession Chromosome Start End Strand Confidence




Database links

Mature ame-miR-1175-3p

Accession MIMAT0018507
Description Apis mellifera ame-miR-1175-3p mature miRNA
Sequence 73 - UGAGAUUCACUCCUCCAACUUAC - 95
Evidence experimental
SOLID [1], Illumina [2]

References

  1. PubMed ID: 20807255
    Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera
    "Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F"
    "Insect Mol Biol (2010) 19:799-805

  2. PubMed ID: 26853694
    MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)
    "Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL"
    "Insect Mol Biol (2016) 25:216-226