miRBase entry: ame-mir-3799

Stem-loop ame-mir-3799


Accession
MI0016215
Description
Apis mellifera ame-mir-3799 precursor miRNA


Sequence


ucgaucuuagcguuggAACGAUAUUGAUUGACUCGAUagaaaacuucuggucgacucgauuccaaucguuuccgugcgaauca
..(((....(((..((((((((...((((((.(((((((((...)))).))))).))))))...))))))))..)))..))).

Structure
uc   cuua   uu        AUU      C     -    a 
  gau    gcg  ggAACGAU   GAUUGA UCGAU agaa  
  |||    |||  ||||||||   |||||| ||||| |||| a
  cua    cgu  cuuugcua   uuagcu agcug ucuu  
-a   --ag   gc        acc      c     g    c 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
CM000068.5: 1277153-1277235 [-]

Database links

Mature ame-miR-3799-5p

Accession MIMAT0018585
Description Apis mellifera ame-miR-3799-5p mature miRNA
Sequence 17 - AACGAUAUUGAUUGACUCGAU - 37
Evidence experimental
SOLID [1], Illumina [2]

References

  1. PubMed ID: 20807255
    Next-generation small RNA sequencing for microRNAs profiling in the honey bee Apis mellifera
    "Chen X, Yu X, Cai Y, Zheng H, Yu D, Liu G, Zhou Q, Hu S, Hu F"
    "Insect Mol Biol (2010) 19:799-805

  2. PubMed ID: 26853694
    MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)
    "Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL"
    "Insect Mol Biol (2016) 25:216-226