miRBase entry: nlo-mir-125

Stem-loop nlo-mir-125


Accession
MI0016662
Description
Nasonia longicornis nlo-mir-125 precursor miRNA


Sequence


gccgccgcgucgccgguUCCCUGAGACCCUAACUUGUGAcgucgcguacgauaucucacaggcuagauucucugguauuggcgaugagugcugccuuuug
((.(((.((((((((((..((.((((..(((.(((((((.((((....))))...))))))).)))..)))).)).)))))))))).).)).))......

Structure
------  c  - g          UC  U    CC   A       --c    c 
      gc gc c cgucgccggu  CC GAGA  CUA CUUGUGA   gucg g
      || || | ||||||||||  || ||||  ||| |||||||   ||||  
      cg cg g guagcgguua  gg cucu  gau ggacacu   uagc u
guuuuc  u  u a          -u  u    ua   c       cua    a 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
Unknown

Database links

Mature nlo-miR-125

Accession MIMAT0018421
Description Nasonia longicornis nlo-miR-125 mature miRNA
Sequence 18 - UCCCUGAGACCCUAACUUGUGA - 39
Evidence not_experimental

References

  1. Computational Identification and Characterization of Putative miRNAs in Nasonia Species
    "Sathyamurthy G, Swamy NR"
    "Int J Insect Sci. (2010) 2:1-13