miRBase entry: pma-mir-135a

Stem-loop pma-mir-135a


Accession
MI0017071
Description
Petromyzon marinus pma-mir-135a precursor miRNA


Sequence


uuguaucugugcuuUAUGGCUUUUUAUUCCUAUGUGAuugcuucuguaaccucGCGUAGGGGUGAAAGCCAUGGAacacggugcaa
.((((.(((((.((((((((((((.((((((((((((((((....))))..)))))))))))))))))))))))).))))))))).

Structure
u    u     c            U            --    u 
 ugua cugug uuUAUGGCUUUU AUUCCUAUGUGA  uugc u
 |||| ||||| |||||||||||| ||||||||||||  ||||  
 acgu ggcac AGGUACCGAAAG UGGGGAUGCGcu  aaug c
a    -     a            -            cc    u 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
GL476647.1: 647673-647758 [-]

Database links

Mature pma-miR-135a-5p

Accession MIMAT0019463
Description Petromyzon marinus pma-miR-135a-5p mature miRNA
Sequence 15 - UAUGGCUUUUUAUUCCUAUGUGA - 37
Evidence experimental
454 [1]

Mature pma-miR-135a-3p

Accession MIMAT0019464
Description Petromyzon marinus pma-miR-135a-3p mature miRNA
Sequence 54 - GCGUAGGGGUGAAAGCCAUGGA - 75
Evidence experimental
454 [1]

References

  1. PubMed ID: 20959416
    microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate
    "Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ"
    "Proc Natl Acad Sci U S A (2010) 107:19379-19383