miRBase entry: pma-mir-200b

Stem-loop pma-mir-200b


Accession
MI0017103
Description
Petromyzon marinus pma-mir-200b precursor miRNA


Sequence


ggagcugcugcCAUCUUACCUGGUGGUAUUGGGucaaacugaauucUAAUACUGCCUGGUAAUGAUGGUggccgccca
((.((.((((((((((((((.(((((((((((((((...)))..)))))))))))).))))).))))))))).)))).

Structure
-  a  u         -     U            --   a 
 gg gc gcugcCAUC UUACC GGUGGUAUUGGG  uca  
 || || ||||||||| ||||| ||||||||||||  ||| a
 cc cg cggUGGUAG AAUGG CCGUCAUAAUcu  agu  
a  -  c         U     U            ua   c 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
Unknown

Database links

Mature pma-miR-200b-5p

Accession MIMAT0019509
Description Petromyzon marinus pma-miR-200b-5p mature miRNA
Sequence 12 - CAUCUUACCUGGUGGUAUUGGG - 33
Evidence experimental
454 [1]

Mature pma-miR-200b-3p

Accession MIMAT0019510
Description Petromyzon marinus pma-miR-200b-3p mature miRNA
Sequence 47 - UAAUACUGCCUGGUAAUGAUGGU - 69
Evidence experimental
454 [1]

References

  1. PubMed ID: 20959416
    microRNAs reveal the interrelationships of hagfish, lampreys, and gnathostomes and the nature of the ancestral vertebrate
    "Heimberg AM, Cowper-Sal-lari R, Semon M, Donoghue PC, Peterson KJ"
    "Proc Natl Acad Sci U S A (2010) 107:19379-19383