MIR4749 is a molecular entity that has been studied in the context of its interaction with human serum albumin (HSA) [PMC8835948]. The research utilized fluorescence spectroscopy to investigate the binding between HSA and MIR4749 [PMC8835948]. The distance between the donor and acceptor (DDA) in the MIR4749-HSA complex was calculated to be within a range of 3.8 to 4.8 nanometers, with an additional 0.1 nm considered for the dye attached to MIR4749's 5′ end [PMC8835948]. Based on these calculations, complexes with a DDA distance within the range of 3.9 to 4.9 nm were selected for further analysis [PMC8835948].
c C A CCA A uag u cUG GGGG CAGG GGGC UC gcug g ||| |||| |||| |||| || |||| GAC CCCC GUCC CCCG ag ugac c - A C -UC C --- a
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0019885 |
| Description | Homo sapiens hsa-miR-4749-5p mature miRNA |
| Sequence | 3 - UGCGGGGACAGGCCAGGGCAUC - 24 |
| Evidence |
experimental
Illumina [1] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0019886 |
| Description | Homo sapiens hsa-miR-4749-3p mature miRNA |
| Sequence | 42 - CGCCCCUCCUGCCCCCACAG - 61 |
| Evidence |
experimental
Illumina [1] |
|