miRBase entry: gma-MIR530a

Stem-loop gma-MIR530a


Accession
MI0017852
Description
Glycine max gma-MIR530a precursor miRNA

Literature search
3 open access papers mention gma-MIR530a
(4 sentences)

Sequence

uugccuuuaucUGCAUUUGCACCUGCACUUUaauuacuugguuucucugugacauaaauaaauauaaauaugucagguaagagaaauauauuauauauaauaugggaauagagguaccgagaacgaggugcaggugcaucugcaggugaa
......(((((((((..((((((((((((((..((.((((((.(((((((..((((..((.((((((((((.((........)).)))).)))))).)).))))...))))))).)))))))).))))))))))))))..))))))))).

Structure
uugccu         UU              aa  a      u       -ga    aa  a      -    g  agg 
      uuaucUGCA  UGCACCUGCACUUU  uu cuuggu ucucugu   caua  ua auauaa auau uc   u
      |||||||||  ||||||||||||||  || |||||| |||||||   ||||  || |||||| |||| ||    
      aguggacgu  acguggacguggag  aa gagcca ggagaua   guau  au uauauu uaua ag   a
-----a         cu              -c  -      u       agg    -a  a      a    a  aga 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr12: 33650621-33650770 [+]

Database links

Mature gma-miR530a

Accession MIMAT0021003
Description Glycine max gma-miR530a mature miRNA
Sequence 12 - UGCAUUUGCACCUGCACUUU - 31
Evidence experimental
454 [1], Illumina [2-3]

References

  1. PubMed ID: 21504877
    MicroRNAs in the shoot apical meristem of soybean
    "Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL"
    "J Exp Bot (2011) 62:2495-2506

  2. PubMed ID: 22156213
    MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
    "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
    "Genes Dev (2011) 25:2540-2553

  3. PubMed ID: 24475082
    Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons
    Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ
    PLoS One (2014) 9:e86153