WARNING: This summary was generated by AI. MIR5090 is a microRNA (miRNA) in Arabidopsis thaliana that plays a crucial role in nitrogen (N) homeostasis and adaptation to N deficiency [PMC8539900]. It is coexpressed with miR826 and both target the ALKENYL HYDROXALKYL PRODUCING 2 (AOP2) gene, which is involved in glucosinolate synthesis, a nitrogen-containing metabolite [PMC5258760]. The overexpression of MIR5090 leads to improved N uptake and tolerance to N limitation, as it post-transcriptionally represses AOP2 expression under N starvation, thereby reallocating nitrogen to essential metabolites for plant survival [PMC8539900]. This miRNA is part of a regulatory network that includes other miRNAs such as miR160 and miR167, which are also responsive to N availability [PMC9551039]. MIR5090's induction under N deficiency suggests its role in the plant's adaptive response by modulating glucosinolate levels through AOP2 suppression [PMC7758431]. The coevolution of MIR5090 with its target gene AOP2 indicates a sophisticated adaptation mechanism for coping with nutrient stress [PMC7696010]. Transgenic Arabidopsis plants overexpressing MIR5090 exhibit better growth and delayed leaf yellowing under low nitrogen conditions, highlighting its potential for improving plant resilience to nutrient limitations [PMC9538721].
- -- ----acCC UU G U aaag ucuga ggu GGGGCAGA GGU UAGGG Gc c ||||| ||| |||||||| ||| ||||| || c ggacu ccg CCCCGUCU CCG AUCCC Cg u a gu accUCAAC -U A C cccg
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Accession | MIMAT0021082 |
| Description | Homo sapiens hsa-miR-5090-5p mature miRNA |
| Sequence | 11 - CCGGGGCAGAUUGGUGUAGGGUG - 33 |
| Evidence |
experimental
Illumina [1], qPCR [1] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0050647 |
| Description | Homo sapiens hsa-miR-5090-3p mature miRNA |
| Sequence | 47 - CCCCCUAAGCCUUCUGCCCCCAACU - 71 |
| Evidence |
experimental
Illumina [1], qPCR [1] |
|