miRBase entry: hsa-mir-5090

Stem-loop hsa-mir-5090


Accession
MI0017979
Symbol
HGNC: MIR5090
Description
Homo sapiens hsa-mir-5090 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR5090 is a nitrogen-responsive microRNA (miRNA) candidate in Arabidopsis that plays a role in nitrogen metabolism and adaptation to nitrogen starvation [PMC8539900]. It is involved in the regulation of glucosinolate synthesis, a process important for nitrogen homeostasis [PMC5258760]. MIR5090, along with other miRNAs such as miR826, has been studied for its relationship with nitrogen metabolism in Arabidopsis [PMC9551039]. It targets the gene ALKENYL HYDROXALKYL PRODUCING 2 (AOP2), which is involved in glucosinolate biosynthesis and is repressed by MIR5090 and miR826 under nitrogen starvation conditions [PMC7696010]. MIR5090 and miR826 may have evolved through inverted duplication of the genomic region containing AOP2, suggesting coevolution in response to nitrogen deprivation [PMC7696010]. AOP2 is confirmed as the common target of both MIR5090 and miR826 [PMC4468412]. Overexpression of MIR5090 or miR826 leads to enhanced tolerance to nitrogen limitation and improved growth under nitrogen-deficient conditions [PMC7758431] [PMC9538721]. These findings highlight the role of MIR5090 as a key regulator of nitrogen metabolism and adaptation to nutrient limitation in Arabidopsis.


Sequence

236 reads, 37 reads per million, 51 experiments
ucugagguacCCGGGGCAGAUUGGUGUAGGGUGcaaagccugcccgcccccuaagccuucugcccccaacuccagccugucagga
((((((((....((((((((..(((.(((((.((...........)).))))).))).))))))))........)))..))))).

Structure
-     --   ----acCC        UU   G     U  aaag 
 ucuga  ggu        GGGGCAGA  GGU UAGGG Gc    c
 |||||  |||        ||||||||  ||| ||||| ||    c
 ggacu  ccg        ccccgucu  ccg auccc cg    u
a     gu   accucaac        -u   a     c  cccg 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr7: 102465742-102465826 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-5090
Name Accession Chromosome Start End Strand Confidence




Database links

Mature hsa-miR-5090

Accession MIMAT0021082
Description Homo sapiens hsa-miR-5090 mature miRNA
Sequence 11 - CCGGGGCAGAUUGGUGUAGGGUG - 33
Evidence experimental
Illumina [1], qPCR [1]
Database links
Predicted targets

References

  1. PubMed ID: 21785231
    Detection of novel human MiRNAs responding to X-ray irradiation
    "Ding N, Wu X, He J, Chang L, Hu W, Li W, Wang J, Wang T, Zhou G"
    "J Radiat Res (2011) 52:425-432