miRBase entry: hsa-mir-5090

Stem-loop hsa-mir-5090


Accession
MI0017979
Symbol
HGNC: MIR5090
Description
Homo sapiens hsa-mir-5090 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR5090 is a microRNA (miRNA) in Arabidopsis thaliana that plays a crucial role in nitrogen (N) homeostasis and adaptation to N deficiency [PMC8539900]. It is coexpressed with miR826 and both target the ALKENYL HYDROXALKYL PRODUCING 2 (AOP2) gene, which is involved in glucosinolate synthesis, a nitrogen-containing metabolite [PMC5258760]. The overexpression of MIR5090 leads to improved N uptake and tolerance to N limitation, as it post-transcriptionally represses AOP2 expression under N starvation, thereby reallocating nitrogen to essential metabolites for plant survival [PMC8539900]. This miRNA is part of a regulatory network that includes other miRNAs such as miR160 and miR167, which are also responsive to N availability [PMC9551039]. MIR5090's induction under N deficiency suggests its role in the plant's adaptive response by modulating glucosinolate levels through AOP2 suppression [PMC7758431]. The coevolution of MIR5090 with its target gene AOP2 indicates a sophisticated adaptation mechanism for coping with nutrient stress [PMC7696010]. Transgenic Arabidopsis plants overexpressing MIR5090 exhibit better growth and delayed leaf yellowing under low nitrogen conditions, highlighting its potential for improving plant resilience to nutrient limitations [PMC9538721].


Sequence

236 reads, 37 reads per million, 51 experiments
ucugagguacCCGGGGCAGAUUGGUGUAGGGUGcaaagccugcccgcccccuaagccuucugcccccaacuccagccugucagga
((((((((....((((((((..(((.(((((.((...........)).))))).))).))))))))........)))..))))).

Structure
-     --   ----acCC        UU   G     U  aaag 
 ucuga  ggu        GGGGCAGA  GGU UAGGG Gc    c
 |||||  |||        ||||||||  ||| ||||| ||    c
 ggacu  ccg        ccccgucu  ccg auccc cg    u
a     gu   accucaac        -u   a     c  cccg 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr7: 102465742-102465826 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-5090
Name Accession Chromosome Start End Strand Confidence




Database links

Mature hsa-miR-5090

Accession MIMAT0021082
Description Homo sapiens hsa-miR-5090 mature miRNA
Sequence 11 - CCGGGGCAGAUUGGUGUAGGGUG - 33
Evidence experimental
Illumina [1], qPCR [1]
Database links
Predicted targets

References

  1. PubMed ID: 21785231
    Detection of novel human MiRNAs responding to X-ray irradiation
    "Ding N, Wu X, He J, Chang L, Hu W, Li W, Wang J, Wang T, Zhou G"
    "J Radiat Res (2011) 52:425-432