miRBase entry: osa-MIR5148c

Stem-loop osa-MIR5148c


Accession
MI0018063
Description
Oryza sativa osa-MIR5148c precursor miRNA


Sequence

48 reads, 33 reads per million, 2 experiments
cacgauaugacguuuguaccccucacaaguacaaguauaaugcaugucaaUGAGGGGUAGAAAUGUCAUAUCAUgugug
(((((((((((((((.(((((((((...(.(((.(((...))).))))..))))))))).))))))))))))..)))..

Structure
--   --            g         caa u   a   u 
  cac  gauaugacguuu uaccccuca   g aca gua  
  |||  |||||||||||| |||||||||   | ||| ||| a
  gug  CUAUACUGUAAA AUGGGGAGU   c ugu cgu  
gu   UA            G         -aa -   a   a 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
Chr11: 2813203-2813281 [-]

Database links

Mature osa-miR5148c

Accession MIMAT0021096
Description Oryza sativa osa-miR5148c mature miRNA
Sequence 51 - UGAGGGGUAGAAAUGUCAUAUCAU - 74
Evidence experimental
Illumina [1]
Database links

References

  1. PubMed ID: 21525786
    Genome-wide discovery and analysis of microRNAs and other small RNAs from rice embryogenic callus
    "Chen CJ, liu Q, Zhang YC, Qu LH, Chen YQ, Gautheret D"
    "RNA Biol (2011) 8:538-547