miRBase entry: hsa-mir-5100

Stem-loop hsa-mir-5100


Accession
MI0019116
Symbol
HGNC: MIR5100
Description
Homo sapiens hsa-mir-5100 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR5100 is a microRNA molecule that plays a significant role in the regulation of mouse bone marrow-derived mesenchymal stem cell (BMSC) proliferation and migration [PMC9391248]. Transfection of BMSCs with MIR5100 mimics resulted in changes in the level of transcripts involved in adhesion, migration, and IGF signaling [PMC9391248]. Additionally, MIR5100 upregulation in BMSCs led to the downregulation of MMP12 and IGFBP2 proteins [PMC9391248]. MIR5100 was also found to promote the proliferation and migration of lung cancer cells [PMC9391248'>PMC9391248'>PMC9391248'>PMC9391248]. In co-culture experiments, the presence of MIR5100-transfected BMSCs increased human myoblast fusion, which was dependent on IGFBP2 [PMC9391248]. Furthermore, MIR5100 downregulated TOB2 expression and promoted osteogenic differentiation of BMSCs [PMC9391248]. Microarray analysis revealed that MIR5100 modified the expression of transcripts involved in cellular movement and cell-to-cell signaling and interaction [PMC9391248]. The presence of MIR5100 mimics also led to significant changes in gene expression profiles [PMC9391248]. Overall, these findings highlight the role of MIR5100 in regulating cell proliferation, migration, fusion, and differentiation processes.

Literature search
4 open access papers mention hsa-mir-5100
(9 sentences)

Sequence

420 reads, 11 reads per million, 97 experiments
ccaugaggagcuggcagugggauggccuggggguaggagcguggcuucuggagcuagaccacaugggUUCAGAUCCCAGCGGUGCCUCUaacuggccacaggaccuugggcagucagcu
((....))(((((((.(((((.(((((((((((((...((.(((..((((((.(((.......))).))))))..)))))..))))))))...))))).....)))...)).)))))))

Structure
ccaugagg       a  ---   ----a     ---        gga  g   cu      g   ga 
        agcuggc gu   ggg     uggcc   ugggggua   gc ugg  ucugga cua  c
        ||||||| ||   |||     |||||   ||||||||   || |||  |||||| |||  c
        ucgacug cg   ucc     accgg   aUCUCCGU   CG ACC  AGACUU ggu  a
--------       a  ggu   aggac     uca        -GG  -   CU      g   ac 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr10: 42997563-42997681 [+]

Disease association
hsa-mir-5100 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-5100

Accession MIMAT0022259
Description Homo sapiens hsa-miR-5100 mature miRNA
Sequence 68 - UUCAGAUCCCAGCGGUGCCUCU - 89
Evidence experimental
SOLiD [1]
Database links
Predicted targets

References

  1. PubMed ID: 21895886
    Deep sequencing of short RNAs reveals novel microRNAs in minor salivary glands of patients with Sjogren's syndrome
    "Tandon M, Gallo A, Jang SI, Illei GG, Alevizos I"
    "Oral Dis (2012) 18:127-131