MIR5100 is a microRNA implicated in the regulation of various cellular processes in mouse bone marrow stromal cells (BMSCs) [PMC9391248]. It has been shown to play a significant role in the regulation of BMSC proliferation and migration [PMC9391248]. Transfection of BMSCs with MIR5100 mimics resulted in altered expression levels of transcripts related to adhesion, migration, and IGF signaling, with a notable downregulation of MMP12 and IGFBP2 proteins [PMC9391248]. MIR5100 also affects the fusion of human myoblasts in vitro, suggesting its role in cellular movement and interaction [PMC9391248'>PMC9391248'>PMC9391248]. Additionally, MIR5100 has been associated with the promotion of osteogenic differentiation by downregulating TOB2 expression [PMC9391248]. In cancer cells, MIR5100 is involved in proliferation and migration through mechanisms such as targeting TOB2 and activating SMAD2/3 signaling pathways [PMC9391248]. The microRNA's overexpression leads to significant changes in gene expression profiles within BMSCs, indicating its potential as a target for modulating cell behavior [PMC9391248].
ccaugagg a --- ----a --- gga g cu g ga agcuggc gu ggg uggcc ugggggua gc ugg ucugga cua c ||||||| || ||| ||||| |||||||| || ||| |||||| ||| c ucgacug cg ucc accgg aUCUCCGU CG ACC AGACUU ggu a -------- a ggu aggac uca -GG - CU g ac
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0022259 |
Description | Homo sapiens hsa-miR-5100 mature miRNA |
Sequence | 68 - UUCAGAUCCCAGCGGUGCCUCU - 89 |
Evidence |
experimental
SOLiD [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|