miRBase entry: hsa-mir-5100

Stem-loop hsa-mir-5100


Accession
MI0019116
Symbol
HGNC: MIR5100
Description
Homo sapiens hsa-mir-5100 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR5100 is a microRNA implicated in the regulation of various cellular processes in mouse bone marrow stromal cells (BMSCs) [PMC9391248]. It has been shown to play a significant role in the regulation of BMSC proliferation and migration [PMC9391248]. Transfection of BMSCs with MIR5100 mimics resulted in altered expression levels of transcripts related to adhesion, migration, and IGF signaling, with a notable downregulation of MMP12 and IGFBP2 proteins [PMC9391248]. MIR5100 also affects the fusion of human myoblasts in vitro, suggesting its role in cellular movement and interaction [PMC9391248'>PMC9391248'>PMC9391248]. Additionally, MIR5100 has been associated with the promotion of osteogenic differentiation by downregulating TOB2 expression [PMC9391248]. In cancer cells, MIR5100 is involved in proliferation and migration through mechanisms such as targeting TOB2 and activating SMAD2/3 signaling pathways [PMC9391248]. The microRNA's overexpression leads to significant changes in gene expression profiles within BMSCs, indicating its potential as a target for modulating cell behavior [PMC9391248].

Literature search
4 open access papers mention hsa-mir-5100
(9 sentences)

Sequence

420 reads, 3 reads per million, 97 experiments
ccaugaggagcuggcagugggauggccuggggguaggagcguggcuucuggagcuagaccacaugggUUCAGAUCCCAGCGGUGCCUCUaacuggccacaggaccuugggcagucagcu
((....))(((((((.(((((.(((((((((((((...((.(((..((((((.(((.......))).))))))..)))))..))))))))...))))).....)))...)).)))))))

Structure
ccaugagg       a  ---   ----a     ---        gga  g   cu      g   ga 
        agcuggc gu   ggg     uggcc   ugggggua   gc ugg  ucugga cua  c
        ||||||| ||   |||     |||||   ||||||||   || |||  |||||| |||  c
        ucgacug cg   ucc     accgg   aUCUCCGU   CG ACC  AGACUU ggu  a
--------       a  ggu   aggac     uca        -GG  -   CU      g   ac 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr10: 42997563-42997681 [+]

Disease association
hsa-mir-5100 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-5100

Accession MIMAT0022259
Description Homo sapiens hsa-miR-5100 mature miRNA
Sequence 68 - UUCAGAUCCCAGCGGUGCCUCU - 89
Evidence experimental
SOLiD [1]
Database links
Predicted targets

References

  1. PubMed ID: 21895886
    Deep sequencing of short RNAs reveals novel microRNAs in minor salivary glands of patients with Sjogren's syndrome
    "Tandon M, Gallo A, Jang SI, Illei GG, Alevizos I"
    "Oral Dis (2012) 18:127-131