MIR5100 is a microRNA molecule that plays a significant role in the regulation of mouse bone marrow-derived mesenchymal stem cell (BMSC) proliferation and migration [PMC9391248]. Transfection of BMSCs with MIR5100 mimics resulted in changes in the level of transcripts involved in adhesion, migration, and IGF signaling [PMC9391248]. Additionally, MIR5100 upregulation in BMSCs led to the downregulation of MMP12 and IGFBP2 proteins [PMC9391248]. MIR5100 was also found to promote the proliferation and migration of lung cancer cells [PMC9391248'>PMC9391248'>PMC9391248'>PMC9391248]. In co-culture experiments, the presence of MIR5100-transfected BMSCs increased human myoblast fusion, which was dependent on IGFBP2 [PMC9391248]. Furthermore, MIR5100 downregulated TOB2 expression and promoted osteogenic differentiation of BMSCs [PMC9391248]. Microarray analysis revealed that MIR5100 modified the expression of transcripts involved in cellular movement and cell-to-cell signaling and interaction [PMC9391248]. The presence of MIR5100 mimics also led to significant changes in gene expression profiles [PMC9391248]. Overall, these findings highlight the role of MIR5100 in regulating cell proliferation, migration, fusion, and differentiation processes.
ccaugagg a --- ----a --- gga g cu g ga agcuggc gu ggg uggcc ugggggua gc ugg ucugga cua c ||||||| || ||| ||||| |||||||| || ||| |||||| ||| c ucgacug cg ucc accgg aUCUCCGU CG ACC AGACUU ggu a -------- a ggu aggac uca -GG - CU g ac
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0022259 |
Description | Homo sapiens hsa-miR-5100 mature miRNA |
Sequence | 68 - UUCAGAUCCCAGCGGUGCCUCU - 89 |
Evidence |
experimental
SOLiD [1] |
Database links | |
Predicted targets |
|