miRBase entry: gma-MIR5765

Stem-loop gma-MIR5765


Accession
MI0019707
Description
Glycine max gma-MIR5765 precursor miRNA


Sequence


acaggucgaaCGAAACGUUGAGGUAUAUGUGGACuacaugguugucaagucuccaagcauaccccaacauguggcagaccuag
..(((((...((....((((.(((((.((.((((((((....)))..))))).))...))))).))))...))...)))))..

Structure
ac     gaa  AAAC    A     --A  U     --   u 
  agguc   CG    GUUG GGUAU   UG GGACu  aca g
  |||||   ||    |||| |||||   || |||||  |||  
  uccag   gu    caac ccaua   ac ucuga  ugu g
ga     acg  -gua    c     cga  c     ac   u 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr15: 31455959-31456041 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from gma-MIR5765
Name Accession Chromosome Start End Strand Confidence




Database links

Mature gma-miR5765

Accession MIMAT0023162
Description Glycine max gma-miR5765 mature miRNA
Sequence 11 - CGAAACGUUGAGGUAUAUGUGGAC - 34
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 22156213
    MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
    "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
    "Genes Dev (2011) 25:2540-2553